Incidental Mutation 'R4577:L3mbtl2'
ID342584
Institutional Source Beutler Lab
Gene Symbol L3mbtl2
Ensembl Gene ENSMUSG00000022394
Gene NameL3MBTL2 polycomb repressive complex 1 subunit
Synonymsm4mbt, 4732493N06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4577 (G1)
Quality Score218
Status Not validated
Chromosome15
Chromosomal Location81663889-81688315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81686285 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 655 (E655K)
Ref Sequence ENSEMBL: ENSMUSP00000133967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023029] [ENSMUST00000072910] [ENSMUST00000172568] [ENSMUST00000172748] [ENSMUST00000173598] [ENSMUST00000174229]
Predicted Effect probably benign
Transcript: ENSMUST00000023029
AA Change: E655K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023029
Gene: ENSMUSG00000022394
AA Change: E655K

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 6e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072910
SMART Domains Protein: ENSMUSP00000072682
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
LRRNT 31 65 3.72e-4 SMART
LRR 59 83 1e1 SMART
LRR_TYP 84 107 7.78e-3 SMART
LRR_TYP 108 131 5.81e-2 SMART
LRR_TYP 132 155 3.89e-3 SMART
LRR_TYP 156 179 6.42e-4 SMART
LRR 180 203 1.37e1 SMART
LRR_TYP 204 227 5.5e-3 SMART
LRR 252 275 3.24e0 SMART
LRR 276 299 2.92e1 SMART
LRRCT 309 357 3.81e-2 SMART
low complexity region 358 372 N/A INTRINSIC
LRRNT 394 428 1.51e-4 SMART
LRR 427 446 1.26e2 SMART
LRR 447 470 3.97e0 SMART
LRR 471 494 1.08e-1 SMART
LRR 496 518 6.23e1 SMART
LRR 519 542 9.48e0 SMART
LRR 544 566 6.96e0 SMART
LRR 568 590 1.14e0 SMART
LRR_TYP 591 614 7.09e-6 SMART
LRR 617 639 3.76e1 SMART
LRR 640 665 6.59e1 SMART
LRRCT 674 722 2.87e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172620
Predicted Effect probably benign
Transcript: ENSMUST00000172748
AA Change: E655K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134333
Gene: ENSMUSG00000022394
AA Change: E655K

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 1e-13 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173598
SMART Domains Protein: ENSMUSP00000133834
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 5 28 1.08e-1 SMART
LRR 30 52 6.23e1 SMART
LRR 53 76 9.48e0 SMART
LRR 78 100 6.96e0 SMART
LRR 102 124 1.14e0 SMART
LRR_TYP 125 148 7.09e-6 SMART
LRR 151 173 3.76e1 SMART
LRR 174 199 6.59e1 SMART
LRRCT 208 256 2.87e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173761
Predicted Effect probably benign
Transcript: ENSMUST00000173898
SMART Domains Protein: ENSMUSP00000133981
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 21 40 1.26e2 SMART
LRR 41 64 3.97e0 SMART
LRR 65 88 1.08e-1 SMART
LRR 90 112 6.23e1 SMART
LRR 113 136 9.48e0 SMART
LRR 138 160 6.96e0 SMART
LRR 162 184 1.14e0 SMART
LRR_TYP 185 208 7.09e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174229
AA Change: E655K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133967
Gene: ENSMUSG00000022394
AA Change: E655K

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 8e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174401
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit failure of the inner cell mass to form a normal primitive ectoderm capable of gastrulation leading to abnormal embryo development, embryonic growth arrest, and lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in L3mbtl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:L3mbtl2 APN 15 81684898 missense possibly damaging 0.89
IGL01380:L3mbtl2 APN 15 81671125 missense possibly damaging 0.75
IGL01479:L3mbtl2 APN 15 81676392 missense probably benign 0.05
IGL02943:L3mbtl2 APN 15 81686255 missense possibly damaging 0.56
IGL03406:L3mbtl2 APN 15 81681993 missense probably damaging 1.00
PIT4431001:L3mbtl2 UTSW 15 81676307 missense probably benign 0.32
R0393:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0394:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0449:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0565:L3mbtl2 UTSW 15 81684286 splice site probably benign
R1263:L3mbtl2 UTSW 15 81682968 missense probably benign 0.00
R1426:L3mbtl2 UTSW 15 81676317 missense possibly damaging 0.95
R1542:L3mbtl2 UTSW 15 81682151 missense probably null 0.45
R1556:L3mbtl2 UTSW 15 81682002 missense probably benign 0.23
R1922:L3mbtl2 UTSW 15 81675621 missense probably damaging 1.00
R2135:L3mbtl2 UTSW 15 81682014 missense possibly damaging 0.94
R2237:L3mbtl2 UTSW 15 81684330 missense probably benign
R4112:L3mbtl2 UTSW 15 81681969 missense possibly damaging 0.90
R4583:L3mbtl2 UTSW 15 81684906 missense probably damaging 1.00
R4779:L3mbtl2 UTSW 15 81682612 missense probably benign
R4787:L3mbtl2 UTSW 15 81663974 utr 5 prime probably benign
R5448:L3mbtl2 UTSW 15 81684333 missense possibly damaging 0.93
R5776:L3mbtl2 UTSW 15 81684871 missense probably damaging 1.00
R6019:L3mbtl2 UTSW 15 81686942 missense probably benign 0.00
R6058:L3mbtl2 UTSW 15 81667354 missense probably benign
R6259:L3mbtl2 UTSW 15 81681927 missense probably damaging 1.00
R7178:L3mbtl2 UTSW 15 81671074 missense probably benign 0.00
R7311:L3mbtl2 UTSW 15 81667387 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCACACTACTTTGACCTCAGG -3'
(R):5'- TCCGTGCCTGGAAAATCTCC -3'

Sequencing Primer
(F):5'- AAATTGGGGTCCAGGTCCAC -3'
(R):5'- CGTGCCTGGAAAATCTCCTTTAAG -3'
Posted On2015-09-24