Mutagenetix > Incidental Mutations

Incidental Mutation 'R4577:Myo5a'

342563

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R4577 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75217545 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1792 (E1792G)

Ref Sequence

ENSEMBL: ENSMUSP00000116028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]

PDB Structure

Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000123128
AA Change: E1792G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: E1792G

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136604

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136731
AA Change: E1767G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: E1767G

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000148144
AA Change: E524G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593
AA Change: E524G

Domain	Start	End	E-Value	Type
coiled coil region	71	175	N/A	INTRINSIC
Blast:DIL	275	305	4e-13	BLAST
Blast:DIL	330	355	5e-6	BLAST
DIL	417	522	2.47e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155282
AA Change: E1794G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: E1794G

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	G	7: 139,978,130	I51T	probably damaging	Het
Abca1	C	A	4: 53,062,568	C1429F	possibly damaging	Het
Acacb	A	G	5: 114,226,831	E1524G	probably damaging	Het
Ankrd50	A	G	3: 38,455,941	V759A	probably damaging	Het
Ano9	T	C	7: 141,104,138	Q538R	probably damaging	Het
Bnip2	A	G	9: 69,997,162	D67G	probably benign	Het
Cacna1e	A	T	1: 154,402,027	S2060T	possibly damaging	Het
Cand2	G	A	6: 115,791,259	C455Y	probably damaging	Het
Cdh16	T	C	8: 104,618,559	D366G	probably damaging	Het
Cep170b	A	G	12: 112,744,718	R595G	probably damaging	Het
Chaf1a	G	A	17: 56,065,184	R784Q	probably damaging	Het
Clca4a	C	A	3: 144,954,969	S698I	probably damaging	Het
Dnah5	A	C	15: 28,289,250	Y1195S	probably benign	Het
Dysf	T	C	6: 84,137,326	I1229T	probably damaging	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Ep300	T	C	15: 81,649,009	S1756P	unknown	Het
Ep300	T	A	15: 81,611,410		probably benign	Het
F3	A	G	3: 121,734,114	I254V	probably benign	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Frmd4a	C	A	2: 4,603,679	A786E	possibly damaging	Het
Fsd1l	T	C	4: 53,686,397	F270S	probably damaging	Het
Galnt3	T	C	2: 66,097,859	Y231C	probably benign	Het
Gm10220	A	C	5: 26,117,871	I181S	probably benign	Het
Gm13178	A	C	4: 144,703,753	I222S	probably damaging	Het
Gnb5	G	A	9: 75,343,541	V316I	possibly damaging	Het
Gys2	A	G	6: 142,454,510	F325S	possibly damaging	Het
Hmgn2	G	A	4: 133,967,357		probably benign	Het
Hsph1	A	G	5: 149,618,843	V705A	probably benign	Het
Ighg2b	T	C	12: 113,306,892	E206G	unknown	Het
Iqub	A	T	6: 24,501,291	I220N	probably damaging	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Kcnq3	T	C	15: 66,286,214	K4R	unknown	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
L3mbtl2	G	A	15: 81,686,285	E655K	probably benign	Het
Lrp1b	C	T	2: 40,821,719	C3163Y	probably damaging	Het
Map3k19	T	A	1: 127,822,813	R934*	probably null	Het
Map4	A	G	9: 110,081,421	T1061A	possibly damaging	Het
Mbnl1	G	A	3: 60,529,778	V50I	probably damaging	Het
Med15	G	A	16: 17,674,515	Q132*	probably null	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mtmr3	G	C	11: 4,497,375	L361V	probably damaging	Het
Nup88	C	A	11: 70,969,717	A55S	probably damaging	Het
Olfr1252	T	C	2: 89,722,043	K23E	possibly damaging	Het
Olfr374	T	A	8: 72,110,323	Y252*	probably null	Het
Pacs1	G	T	19: 5,143,833	S556*	probably null	Het
Parp4	A	G	14: 56,590,410	E206G	probably benign	Het
Paxbp1	T	G	16: 91,015,154	K889N	probably damaging	Het
Pcdhga2	G	A	18: 37,669,249	A49T	possibly damaging	Het
Pcsk6	T	A	7: 65,959,266	L292*	probably null	Het
Plb1	C	T	5: 32,247,557	Q20*	probably null	Het
Plec	C	A	15: 76,184,069	Q1142H	possibly damaging	Het
Pnpla2	T	C	7: 141,457,344	S87P	probably damaging	Het
Prss28	T	C	17: 25,310,105	V140A	probably damaging	Het
Rad17	A	T	13: 100,633,278	S258T	probably damaging	Het
Rnf111	A	T	9: 70,429,584	C932*	probably null	Het
Sdc2	T	C	15: 33,017,132	Y31H	probably damaging	Het
Selenoh	T	C	2: 84,670,331	E55G	possibly damaging	Het
Serpina3k	T	G	12: 104,344,192	V327G	possibly damaging	Het
Setd1b	A	G	5: 123,148,616	E575G	unknown	Het
Slco1a4	A	T	6: 141,819,540	S325R	probably damaging	Het
Smtnl1	C	A	2: 84,818,443	V156L	possibly damaging	Het
Speg	A	G	1: 75,415,395	D1607G	probably damaging	Het
Tctex1d4	A	G	4: 117,128,615	T212A	possibly damaging	Het
Tmem101	T	A	11: 102,155,837	M69L	possibly damaging	Het
Treh	G	A	9: 44,685,911	M542I	probably benign	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Ttc6	T	C	12: 57,576,655	I280T	probably benign	Het
Ubtfl1	A	G	9: 18,409,493	T106A	probably damaging	Het
Wdr27	T	C	17: 14,903,462	H583R	probably benign	Het
Xirp2	C	T	2: 67,513,897	P2161S	probably damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211127	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	unclassified	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	synonymous	probably null
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAGTGCCCTTCAGTTCCTC -3'
(R):5'- AGGGTATCAATCCTTCCAACTTG -3'

Sequencing Primer
(F):5'- GCCCTTCAGTTCCTCCTTCG -3'
(R):5'- CCTTCCAACTTGCAAGATATTTTTC -3'

Posted On

2015-09-24