Incidental Mutation 'R4619:Cdh15'
ID 345178
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Name cadherin 15
Synonyms M cadherin, Mcad, Cdh14
MMRRC Submission 041885-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4619 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 123575113-123594136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123587612 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 179 (D179N)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
AlphaFold P33146
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: D179N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: D179N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.8987 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,775,520 (GRCm39) V1570I probably damaging Het
Alx4 A G 2: 93,473,106 (GRCm39) R35G probably damaging Het
Apod T C 16: 31,116,211 (GRCm39) D173G probably benign Het
Atp8b3 G A 10: 80,361,858 (GRCm39) T731I possibly damaging Het
Birc6 A C 17: 74,947,145 (GRCm39) T2955P probably benign Het
Cntnap5c G T 17: 58,717,263 (GRCm39) V1282L probably benign Het
Crocc2 G A 1: 93,141,372 (GRCm39) R1175H probably benign Het
Dbh A G 2: 27,064,836 (GRCm39) D349G probably damaging Het
Dync1h1 A G 12: 110,605,278 (GRCm39) I2372V probably benign Het
Fer1l4 A T 2: 155,889,007 (GRCm39) W389R probably damaging Het
Fndc1 T C 17: 7,984,036 (GRCm39) T1297A unknown Het
Gart T C 16: 91,422,321 (GRCm39) N732S probably damaging Het
Gas2l2 T C 11: 83,313,924 (GRCm39) I463V probably benign Het
Gm5591 G A 7: 38,220,072 (GRCm39) S267L probably benign Het
Gzmk A G 13: 113,309,657 (GRCm39) V92A probably damaging Het
Hspg2 C T 4: 137,273,884 (GRCm39) R2680W probably damaging Het
Insyn2a A G 7: 134,520,270 (GRCm39) Y87H probably damaging Het
Kcnh3 G A 15: 99,131,982 (GRCm39) V646M probably damaging Het
Kcnk7 A C 19: 5,756,463 (GRCm39) I230L probably benign Het
Kif3b C T 2: 153,158,594 (GRCm39) R132* probably null Het
Klra5 T C 6: 129,885,776 (GRCm39) S128G probably benign Het
Krba1 C T 6: 48,383,282 (GRCm39) R4* probably null Het
Krt1c T A 15: 101,726,026 (GRCm39) I171F probably damaging Het
Lss A G 10: 76,372,089 (GRCm39) D148G probably benign Het
Mavs G T 2: 131,082,370 (GRCm39) A85S probably damaging Het
Mipep T C 14: 61,140,865 (GRCm39) C566R probably damaging Het
Myocd T A 11: 65,069,254 (GRCm39) probably benign Het
Ndufa9 C T 6: 126,804,498 (GRCm39) probably null Het
Nolc1 G A 19: 46,071,959 (GRCm39) G583D probably damaging Het
Nucb2 T C 7: 116,127,059 (GRCm39) probably null Het
Or1i2 T C 10: 78,448,409 (GRCm39) D22G probably benign Het
Or52e19 C T 7: 102,959,165 (GRCm39) T79I probably benign Het
Or5p63 A T 7: 107,811,301 (GRCm39) I145N possibly damaging Het
Pank4 C A 4: 155,061,076 (GRCm39) D508E probably benign Het
Phb1 T A 11: 95,562,416 (GRCm39) probably benign Het
Pign T A 1: 105,449,715 (GRCm39) probably benign Het
Plec T C 15: 76,076,382 (GRCm39) K349E probably benign Het
Ppp1r3c A T 19: 36,711,743 (GRCm39) V9E possibly damaging Het
Rap1gap T A 4: 137,443,422 (GRCm39) V130D probably damaging Het
Senp3 T A 11: 69,567,944 (GRCm39) Y432F probably benign Het
Serpina3f T C 12: 104,183,549 (GRCm39) I137T possibly damaging Het
Slc46a3 T A 5: 147,823,540 (GRCm39) K101* probably null Het
Snph G A 2: 151,436,434 (GRCm39) Q96* probably null Het
Sptb A T 12: 76,630,581 (GRCm39) C2244* probably null Het
Srbd1 A T 17: 86,416,693 (GRCm39) F488L probably benign Het
Ssc5d A T 7: 4,932,524 (GRCm39) H396L probably damaging Het
Sulf1 A C 1: 12,856,876 (GRCm39) R42S probably damaging Het
Taf1a T A 1: 183,181,752 (GRCm39) probably benign Het
Thoc5 T A 11: 4,876,218 (GRCm39) M609K probably damaging Het
Tiam2 A T 17: 3,568,617 (GRCm39) I1588F probably damaging Het
Tmcc1 C T 6: 116,020,247 (GRCm39) V402I probably damaging Het
Tmprss15 T C 16: 78,818,358 (GRCm39) D524G probably damaging Het
Trbv31 T C 6: 41,534,901 (GRCm39) I21V probably benign Het
Vmn1r74 A T 7: 11,581,398 (GRCm39) T233S possibly damaging Het
Vmn1r74 G C 7: 11,581,403 (GRCm39) Q234H probably damaging Het
Vsx1 A T 2: 150,530,529 (GRCm39) S118T probably benign Het
Wnt9b G A 11: 103,621,949 (GRCm39) T236I probably benign Het
Zbtb21 T C 16: 97,751,092 (GRCm39) T1092A possibly damaging Het
Zc3hc1 G A 6: 30,387,523 (GRCm39) T52I probably benign Het
Zfp558 T A 9: 18,367,577 (GRCm39) N404Y possibly damaging Het
Zfp735 A T 11: 73,602,031 (GRCm39) D325V probably damaging Het
Zhx3 A T 2: 160,623,879 (GRCm39) M96K probably damaging Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 123,592,062 (GRCm39) intron probably benign
IGL01958:Cdh15 APN 8 123,586,089 (GRCm39) missense probably damaging 1.00
IGL02588:Cdh15 APN 8 123,583,291 (GRCm39) nonsense probably null
IGL02793:Cdh15 APN 8 123,587,721 (GRCm39) missense probably damaging 1.00
IGL02947:Cdh15 APN 8 123,592,111 (GRCm39) missense probably benign 0.00
R0310:Cdh15 UTSW 8 123,592,175 (GRCm39) missense probably damaging 1.00
R0441:Cdh15 UTSW 8 123,587,705 (GRCm39) missense probably damaging 1.00
R0766:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R0898:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1023:Cdh15 UTSW 8 123,591,939 (GRCm39) missense probably damaging 0.98
R1054:Cdh15 UTSW 8 123,591,076 (GRCm39) missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R1081:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1101:Cdh15 UTSW 8 123,587,585 (GRCm39) missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1209:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1210:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1312:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R1317:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1318:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1393:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1428:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1429:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1695:Cdh15 UTSW 8 123,588,755 (GRCm39) missense probably benign 0.05
R2157:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2170:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2178:Cdh15 UTSW 8 123,591,715 (GRCm39) splice site probably null
R2252:Cdh15 UTSW 8 123,584,161 (GRCm39) missense probably damaging 1.00
R2290:Cdh15 UTSW 8 123,586,056 (GRCm39) missense probably damaging 1.00
R2317:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2330:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2345:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2349:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2353:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2354:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2566:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2567:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2568:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2893:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2894:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2937:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2938:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2990:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2992:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2993:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3029:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3030:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3195:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R3441:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3442:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3608:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3686:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4119:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4120:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4477:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4478:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4480:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4580:Cdh15 UTSW 8 123,591,897 (GRCm39) missense probably damaging 0.99
R4583:Cdh15 UTSW 8 123,591,767 (GRCm39) missense probably damaging 0.98
R4694:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4731:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R5076:Cdh15 UTSW 8 123,591,087 (GRCm39) missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 123,588,802 (GRCm39) missense probably null 1.00
R5375:Cdh15 UTSW 8 123,591,839 (GRCm39) missense probably damaging 1.00
R5498:Cdh15 UTSW 8 123,591,917 (GRCm39) missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 123,583,326 (GRCm39) missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 123,591,086 (GRCm39) missense probably benign 0.01
R6570:Cdh15 UTSW 8 123,584,130 (GRCm39) missense probably damaging 1.00
R6708:Cdh15 UTSW 8 123,590,294 (GRCm39) missense probably benign 0.32
R7505:Cdh15 UTSW 8 123,575,231 (GRCm39) missense probably benign 0.01
R7527:Cdh15 UTSW 8 123,588,865 (GRCm39) missense probably damaging 1.00
R7724:Cdh15 UTSW 8 123,593,700 (GRCm39) missense probably damaging 1.00
R8093:Cdh15 UTSW 8 123,593,574 (GRCm39) missense probably damaging 1.00
R8485:Cdh15 UTSW 8 123,584,105 (GRCm39) missense probably damaging 1.00
R8759:Cdh15 UTSW 8 123,587,628 (GRCm39) missense probably damaging 1.00
R8910:Cdh15 UTSW 8 123,575,240 (GRCm39) missense probably benign 0.04
R9017:Cdh15 UTSW 8 123,584,256 (GRCm39) critical splice donor site probably null
R9453:Cdh15 UTSW 8 123,586,029 (GRCm39) missense probably damaging 0.99
R9699:Cdh15 UTSW 8 123,588,769 (GRCm39) missense probably benign 0.00
R9705:Cdh15 UTSW 8 123,591,024 (GRCm39) missense probably damaging 1.00
Z1176:Cdh15 UTSW 8 123,590,998 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGACCTCAGTTCCACCATAG -3'
(R):5'- AAGAACCACAGTGCGTGTAG -3'

Sequencing Primer
(F):5'- GACCTCAGTTCCACCATAGTCATG -3'
(R):5'- ACAGTGCGTGTAGGCTGC -3'
Posted On 2015-09-25