Mutagenetix > Incidental Mutations

Incidental Mutation 'R4119:Cdh15'

315232

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

040992-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4119 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122847966-122867397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122863423 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 365 (V365A)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034443
AA Change: V365A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: V365A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.7434

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	G	6: 124,356,904	L39P	probably damaging	Het
Abcc1	A	G	16: 14,394,013	M138V	probably benign	Het
Abl1	T	A	2: 31,801,727	I1067N	probably damaging	Het
Adam6a	C	T	12: 113,544,574	T189I	probably benign	Het
Ankfy1	G	A	11: 72,714,484		probably null	Het
Aplnr	T	C	2: 85,136,966	Y112H	possibly damaging	Het
Arhgap17	A	G	7: 123,306,994	F313S	probably damaging	Het
Arid1b	T	C	17: 4,995,794		probably benign	Het
Bcas1	G	C	2: 170,378,815	P394A	probably benign	Het
Ccdc116	A	G	16: 17,142,187	S213P	probably damaging	Het
Cenpf	A	G	1: 189,653,045	I2346T	probably benign	Het
Chd7	A	G	4: 8,785,658		probably benign	Het
Ezh2	A	C	6: 47,544,548	N390K	probably benign	Het
Fbxo7	C	A	10: 86,021,895		probably benign	Het
Fibin	A	G	2: 110,362,690	Y36H	probably damaging	Het
Gm597	A	T	1: 28,777,973	V326D	probably damaging	Het
Gpr37	C	T	6: 25,688,426	R224H	possibly damaging	Het
Hars2	A	T	18: 36,790,488	N363I	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Itpr1	G	A	6: 108,394,355	D1140N	probably benign	Het
Lrig2	A	G	3: 104,467,195	V190A	probably benign	Het
Ltk	T	A	2: 119,757,948		probably benign	Het
Morc2a	C	A	11: 3,683,868	T660N	probably benign	Het
Msh3	A	G	13: 92,354,011		probably benign	Het
Myo15b	T	C	11: 115,873,492	S1311P	probably benign	Het
Nbeal1	A	T	1: 60,291,870	I2213L	probably damaging	Het
Olfr1122	T	A	2: 87,387,843	M46K	possibly damaging	Het
Olfr1155	A	G	2: 87,943,443	Y62H	probably damaging	Het
P2ry12	T	C	3: 59,217,841	T138A	probably benign	Het
Pirb	T	C	7: 3,717,575	D308G	probably damaging	Het
Pkn3	A	G	2: 30,083,037		probably benign	Het
Ripor1	T	A	8: 105,618,857		probably benign	Het
Ryr2	T	C	13: 11,779,267	T942A	probably benign	Het
Sptbn5	T	A	2: 120,064,529	D798V	possibly damaging	Het
Synpo2	T	A	3: 123,117,150	D282V	probably damaging	Het
Tnik	T	C	3: 28,666,175	F1287L	probably damaging	Het
Tshz1	T	G	18: 84,014,189	K698T	probably benign	Het
Ttc23l	A	C	15: 10,539,920	V159G	probably damaging	Het
Urb2	T	A	8: 124,047,240	D1503E	probably benign	Het
Usp29	T	A	7: 6,962,806	N549K	probably benign	Het
Vmn2r39	G	A	7: 9,023,674	H443Y	probably benign	Het
Zfp24	A	G	18: 24,014,569	Y229H	possibly damaging	Het
Zfp472	T	A	17: 32,978,215	Y421*	probably null	Het
Zkscan3	T	C	13: 21,393,949	E256G	possibly damaging	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	122865323	intron	probably benign
IGL01958:Cdh15	APN	8	122859350	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	122856552	nonsense	probably null
IGL02793:Cdh15	APN	8	122860982	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	122865372	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	122865436	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	122860966	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	122861449	intron	probably benign
R0898:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	122865200	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	122864337	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	122860846	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	122861449	intron	probably benign
R1317:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	122862016	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	122864976	splice site	probably null
R2252:Cdh15	UTSW	8	122857422	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	122859317	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	122865158	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	122865028	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	122860873	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	122864348	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	122862063	missense	probably null	1.00
R5375:Cdh15	UTSW	8	122865100	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	122865178	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	122856587	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	122864347	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	122857391	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	122863555	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	122848492	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	122862126	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	122866961	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	122866835	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	122857366	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	122860889	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	122864259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAAGGCTCTTAACACCTGGC -3'
(R):5'- GATGTACACCAATGGCCTTTCTC -3'

Sequencing Primer
(F):5'- AACACCTGGCATTTCAGCTG -3'
(R):5'- TGCACCCTCAGATTCTAGAGG -3'

Posted On

2015-05-14