Incidental Mutation 'R4654:Zfr2'
ID 351562
Institutional Source Beutler Lab
Gene Symbol Zfr2
Ensembl Gene ENSMUSG00000034949
Gene Name zinc finger RNA binding protein 2
Synonyms 9130206N08Rik, 2010013I23Rik
MMRRC Submission 041914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R4654 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 81233155-81252123 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 81251249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000117798] [ENSMUST00000119547]
AlphaFold E9Q5M4
Predicted Effect probably null
Transcript: ENSMUST00000117798
SMART Domains Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
low complexity region 44 62 N/A INTRINSIC
low complexity region 123 163 N/A INTRINSIC
ZnF_U1 202 236 3.58e-5 SMART
ZnF_C2H2 205 229 7.68e0 SMART
ZnF_U1 249 283 3.78e-4 SMART
ZnF_C2H2 252 276 4.12e0 SMART
ZnF_U1 397 431 3.78e-4 SMART
ZnF_C2H2 400 424 1.99e0 SMART
low complexity region 484 508 N/A INTRINSIC
DZF 585 837 2.06e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119547
SMART Domains Protein: ENSMUSP00000113576
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132174
Predicted Effect probably null
Transcript: ENSMUST00000137999
SMART Domains Protein: ENSMUSP00000120853
Gene: ENSMUSG00000034949

DomainStartEndE-ValueType
Pfam:DZF 2 162 1.3e-32 PFAM
low complexity region 166 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148029
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik T A 9: 35,908,991 C4S probably damaging Het
Adam3 A T 8: 24,703,803 C398S probably damaging Het
Adamts10 A G 17: 33,537,330 K316E possibly damaging Het
AI314180 A T 4: 58,834,523 I785N possibly damaging Het
Ap1m1 T C 8: 72,252,873 F238L possibly damaging Het
Aph1a T A 3: 95,895,776 D180E probably benign Het
Atp9b A G 18: 80,891,878 F201L probably benign Het
Btbd9 A C 17: 30,485,587 probably benign Het
C2cd5 T C 6: 143,030,184 T768A probably benign Het
Casq1 C T 1: 172,210,398 probably benign Het
Cltc A T 11: 86,726,370 M351K probably benign Het
Cnp A G 11: 100,579,051 E271G possibly damaging Het
Col22a1 T C 15: 71,973,695 D406G possibly damaging Het
Cylc2 T C 4: 51,228,279 S117P probably benign Het
Cyp2b13 T C 7: 26,061,647 L43P probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dclk2 T C 3: 86,836,376 D262G probably damaging Het
Dcun1d3 A C 7: 119,859,519 Y98D probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dennd5b T C 6: 149,006,837 N986S probably damaging Het
Dusp9 G A X: 73,640,772 R182Q probably benign Het
Edil3 A G 13: 89,289,470 K397E probably damaging Het
Ehd1 T C 19: 6,276,964 probably benign Het
Fam13a A T 6: 58,987,167 H93Q probably benign Het
Fam207a T C 10: 77,490,026 M170V possibly damaging Het
Fam69a T C 5: 107,910,116 probably null Het
Farp1 T C 14: 121,276,304 I837T possibly damaging Het
Fbxl5 T A 5: 43,765,429 I216F probably damaging Het
Gadl1 G A 9: 115,941,340 E74K probably damaging Het
Gnpnat1 A G 14: 45,380,979 V122A probably damaging Het
Hdac10 C T 15: 89,126,833 probably benign Het
Heatr5b T C 17: 78,820,701 S502G possibly damaging Het
Hr C A 14: 70,563,573 A695E probably damaging Het
Ift80 A T 3: 68,918,537 I490N possibly damaging Het
Ipo11 A G 13: 106,834,184 probably benign Het
Iqch T G 9: 63,524,913 Y400S probably damaging Het
Jag2 C T 12: 112,913,646 D702N probably benign Het
Kiss1r T A 10: 79,921,790 L326Q probably damaging Het
Lexm C A 4: 106,610,415 M341I probably benign Het
Lrrc42 A T 4: 107,247,549 I73N probably damaging Het
Lrrc55 C T 2: 85,196,536 G48D possibly damaging Het
Lrrk2 T C 15: 91,765,681 S1674P probably damaging Het
Mctp2 A G 7: 72,090,194 L816P probably damaging Het
Mipol1 A T 12: 57,306,132 T86S probably benign Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Mmp1b A G 9: 7,370,849 V302A probably benign Het
Msc A T 1: 14,755,829 probably null Het
Msmo1 C A 8: 64,727,854 V9L probably benign Het
Nbeal2 G A 9: 110,632,004 R1630C probably damaging Het
Nlgn1 C T 3: 26,133,701 V12I possibly damaging Het
Npas3 T C 12: 54,062,132 probably null Het
Nr2e3 A G 9: 59,949,072 probably benign Het
Oca2 C T 7: 56,328,812 A576V probably benign Het
Olfr1444 T A 19: 12,862,232 C152* probably null Het
Olfr212 T C 6: 116,516,448 Y224H probably damaging Het
Olfr5 T C 7: 6,481,046 T37A probably benign Het
Parp6 A G 9: 59,641,100 probably null Het
Phlpp1 A T 1: 106,339,501 M715L probably benign Het
Pi4k2a G A 19: 42,113,105 probably null Het
Pik3ap1 A G 19: 41,327,909 S305P probably damaging Het
Plcg2 G A 8: 117,504,315 M45I probably benign Het
Ppm1m A T 9: 106,196,402 L317H probably damaging Het
Ppp1r21 T G 17: 88,558,799 M341R probably benign Het
Prdx3 A G 19: 60,865,236 V217A possibly damaging Het
Ptk2b A G 14: 66,163,047 V773A possibly damaging Het
Raly T C 2: 154,857,456 V60A probably damaging Het
Reps1 A G 10: 18,114,400 D420G probably damaging Het
Rev1 A T 1: 38,079,256 probably benign Het
Rgs2 T G 1: 144,002,912 probably benign Het
Rlf G T 4: 121,150,601 T394K probably benign Het
Rptn A T 3: 93,397,485 R708S possibly damaging Het
Sec23b T A 2: 144,572,574 M402K probably benign Het
Skiv2l A G 17: 34,849,946 C26R probably damaging Het
Smpd4 A G 16: 17,642,128 probably benign Het
Synj2 A G 17: 6,013,538 E434G probably damaging Het
Tatdn2 T A 6: 113,707,365 F64I probably benign Het
Tex21 A C 12: 76,217,086 H177Q probably benign Het
Tln1 T A 4: 43,535,954 Q2077L probably null Het
Tnrc6c T C 11: 117,720,971 V145A probably benign Het
Ttn C T 2: 76,786,592 probably benign Het
Uggt2 A G 14: 119,032,258 F954S possibly damaging Het
Ugt2a1 A G 5: 87,486,224 S175P probably damaging Het
Vcl A G 14: 20,985,752 probably null Het
Vegfa A T 17: 46,025,250 probably benign Het
Vmn2r68 G A 7: 85,233,561 Q328* probably null Het
Vmn2r7 A G 3: 64,719,443 Y142H probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ybx3 G T 6: 131,370,327 R282S probably damaging Het
Zfp566 T C 7: 30,077,769 H329R probably damaging Het
Zfp786 T C 6: 47,820,934 I357V probably benign Het
Other mutations in Zfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfr2 APN 10 81242085 missense probably damaging 0.96
IGL01622:Zfr2 APN 10 81251359 missense probably benign
IGL01623:Zfr2 APN 10 81251359 missense probably benign
IGL02719:Zfr2 APN 10 81244712 missense probably damaging 1.00
IGL03036:Zfr2 APN 10 81242151 missense probably benign 0.01
R0302:Zfr2 UTSW 10 81251336 unclassified probably benign
R0837:Zfr2 UTSW 10 81245408 missense probably damaging 1.00
R1557:Zfr2 UTSW 10 81247391 missense probably benign 0.01
R1714:Zfr2 UTSW 10 81244749 missense probably damaging 1.00
R1737:Zfr2 UTSW 10 81242085 missense probably damaging 0.96
R1991:Zfr2 UTSW 10 81242852 missense possibly damaging 0.86
R2134:Zfr2 UTSW 10 81242901 missense probably damaging 1.00
R2148:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R2150:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R3703:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3704:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3705:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3715:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R4301:Zfr2 UTSW 10 81242184 unclassified probably benign
R4811:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R5290:Zfr2 UTSW 10 81246710 frame shift probably null
R5781:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R7114:Zfr2 UTSW 10 81244725 missense probably damaging 1.00
R8192:Zfr2 UTSW 10 81242815 missense possibly damaging 0.83
R8359:Zfr2 UTSW 10 81242819 missense possibly damaging 0.57
R8389:Zfr2 UTSW 10 81245489 missense probably benign
R8827:Zfr2 UTSW 10 81242785 missense probably benign 0.00
R8953:Zfr2 UTSW 10 81248437 missense probably damaging 0.99
R9086:Zfr2 UTSW 10 81240195 missense probably damaging 0.96
R9189:Zfr2 UTSW 10 81244662 missense probably damaging 1.00
R9487:Zfr2 UTSW 10 81240135 missense probably benign 0.33
R9592:Zfr2 UTSW 10 81233746 missense unknown
R9645:Zfr2 UTSW 10 81248418 nonsense probably null
X0063:Zfr2 UTSW 10 81242957 critical splice donor site probably null
Z1177:Zfr2 UTSW 10 81246084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTACCCAGGAAGTACAGGTGG -3'
(R):5'- GTGGTGATGACTGGCTCAAG -3'

Sequencing Primer
(F):5'- AAGTACAGGTGGGGTCCC -3'
(R):5'- TGGCTCAAGGCAGCCCTG -3'
Posted On 2015-10-08