Incidental Mutation 'R4688:Igfbp7'
ID 353843
Institutional Source Beutler Lab
Gene Symbol Igfbp7
Ensembl Gene ENSMUSG00000036256
Gene Name insulin-like growth factor binding protein 7
Synonyms Fstl2, mac25, AGM
MMRRC Submission 041939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4688 (G1)
Quality Score 121
Status Not validated
Chromosome 5
Chromosomal Location 77349240-77408041 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77407635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 127 (Y127C)
Ref Sequence ENSEMBL: ENSMUSP00000128318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046746] [ENSMUST00000163898]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046746
AA Change: Y127C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045057
Gene: ENSMUSG00000036256
AA Change: Y127C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 166 266 5.53e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163898
AA Change: Y127C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128318
Gene: ENSMUSG00000036256
AA Change: Y127C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 197 297 5.53e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the insulin-like growth factor (IGF)-binding protein (IGFBP) family. IGFBPs bind IGFs with high affinity, and regulate IGF availability in body fluids and tissues and modulate IGF binding to its receptors. This protein binds IGF-I and IGF-II with relatively low affinity, and belongs to a subfamily of low-affinity IGFBPs. It also stimulates prostacyclin production and cell adhesion. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and one variant has been associated with retinal arterial macroaneurysm (PMID:21835307). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit retarded mammary gland developmental in virgin and adult females, reduced mammary gland size and alveolar density during pregnancy, precocious involution in lactating mammary glands, and abnormal milk composition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,449 S530P probably benign Het
1700003E16Rik A G 6: 83,162,698 N535S probably damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
9930021J03Rik A G 19: 29,717,101 I1664T probably benign Het
Abcc12 T C 8: 86,548,694 S452G possibly damaging Het
Acacb C A 5: 114,204,763 Q897K probably benign Het
Acot3 C A 12: 84,053,917 R145S probably damaging Het
AI314180 A G 4: 58,840,757 V667A probably damaging Het
Ankrd54 A T 15: 79,054,582 Y247N probably damaging Het
Arl11 G A 14: 61,311,097 V119I probably benign Het
Atxn7 T A 14: 14,089,288 M268K probably benign Het
Bms1 G A 6: 118,392,706 R934C probably damaging Het
Ccdc129 G A 6: 55,967,147 probably null Het
Chrnb3 T C 8: 27,394,119 S295P probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cnr1 A T 4: 33,944,571 I320F probably benign Het
Cntn4 C T 6: 106,437,949 P147L probably damaging Het
Col24a1 G A 3: 145,314,383 V172I probably benign Het
Col9a3 A G 2: 180,607,631 D262G probably damaging Het
Csrnp2 A G 15: 100,482,360 V350A probably damaging Het
D630045J12Rik A G 6: 38,196,657 V192A possibly damaging Het
Deptor A G 15: 55,208,781 M219V probably benign Het
Dmrtb1 A T 4: 107,684,050 L38Q probably damaging Het
Dvl2 G A 11: 70,007,518 R367Q possibly damaging Het
Dync1h1 T G 12: 110,655,528 I3435S probably damaging Het
Eif2b3 A G 4: 117,058,849 N218D probably benign Het
Epha2 A G 4: 141,318,981 D497G probably benign Het
Epha7 G T 4: 28,821,367 L177F probably damaging Het
Fam214b A G 4: 43,034,663 F352S probably damaging Het
Fam98c C T 7: 29,155,241 E147K probably damaging Het
Fbxo17 A G 7: 28,732,554 T19A probably benign Het
Fbxo47 A G 11: 97,856,223 F339S probably damaging Het
Frmd4a G T 2: 4,537,311 V234L possibly damaging Het
Gal3st2 A G 1: 93,872,523 D32G probably damaging Het
Gpr135 T C 12: 72,070,946 T16A probably benign Het
Gpr160 A T 3: 30,896,686 R302S probably benign Het
Hrh2 C A 13: 54,214,801 N265K probably benign Het
Htatip2 C A 7: 49,773,423 A242E probably damaging Het
Igkv16-104 A G 6: 68,425,894 Q57R possibly damaging Het
Ino80c A G 18: 24,108,846 S161P probably damaging Het
Kcnc1 A G 7: 46,397,835 D53G probably benign Het
Lce1h G T 3: 92,763,567 R93S unknown Het
Lce1k T C 3: 92,806,644 S78G unknown Het
Lhcgr T A 17: 88,765,152 I156F probably damaging Het
Lpl T C 8: 68,899,425 Y343H probably damaging Het
Lrp6 G T 6: 134,479,743 R853S probably damaging Het
Lrrc7 A G 3: 158,148,605 V1322A probably damaging Het
Lrrc74a C T 12: 86,737,698 Q67* probably null Het
Megf6 A T 4: 154,253,814 D447V probably damaging Het
Mep1a T C 17: 43,482,248 D355G possibly damaging Het
Ncoa1 T C 12: 4,315,781 D95G probably benign Het
Npepl1 A T 2: 174,114,442 I139F possibly damaging Het
Nrcam T C 12: 44,547,237 S262P probably benign Het
Nrp1 A G 8: 128,502,566 N842D probably benign Het
Olfml3 A G 3: 103,732,181 probably benign Het
Olfr1375 A G 11: 51,048,988 R294G probably damaging Het
Olfr1505 A T 19: 13,919,241 T74S probably benign Het
Olfr32 T A 2: 90,138,999 N47Y possibly damaging Het
Olfr421-ps1 T C 1: 174,151,596 Y27H possibly damaging Het
Olfr711 T A 7: 106,971,861 Y161F probably benign Het
Olfr773 G A 10: 129,186,645 P259S probably damaging Het
Olfr918 A G 9: 38,673,363 L27P probably damaging Het
Pde2a A G 7: 101,502,834 N316S probably benign Het
Pde4dip T A 3: 97,843,677 R74* probably null Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Piezo1 A T 8: 122,488,539 W1444R probably damaging Het
Pla2g4e T C 2: 120,167,933 K843R possibly damaging Het
Plxna2 C T 1: 194,644,445 P229L probably damaging Het
Prelid3b G T 2: 174,466,799 T131K probably benign Het
Pros1 T C 16: 62,889,007 probably null Het
Prrc2c G T 1: 162,697,687 P450Q unknown Het
Ptbp1 G T 10: 79,856,508 V5F possibly damaging Het
Ptk2 T A 15: 73,206,225 L997F probably damaging Het
Rims1 G T 1: 22,479,447 S525* probably null Het
Sh2b3 T A 5: 121,818,634 D318V probably benign Het
Slc16a13 A T 11: 70,220,275 I88N probably damaging Het
Slit2 T A 5: 48,257,003 probably null Het
Snx10 A G 6: 51,579,938 N67S probably damaging Het
Stil A G 4: 115,041,308 Y1045C probably damaging Het
Stra6 A G 9: 58,135,076 probably null Het
Sympk A G 7: 19,054,410 S1254G probably benign Het
Syt15 G T 14: 34,228,054 G377V probably damaging Het
Taar4 A T 10: 23,960,833 I114F probably damaging Het
Tcaf3 G A 6: 42,593,366 probably null Het
Tgm7 A T 2: 121,094,021 N558K probably benign Het
Tln2 T G 9: 67,397,653 M1L probably benign Het
Trim50 C T 5: 135,367,140 T314I probably damaging Het
Trp53rka A T 2: 165,491,392 Y192* probably null Het
Ube3b T C 5: 114,393,078 V211A probably benign Het
Ush2a A G 1: 188,399,941 S787G probably benign Het
Vmn1r189 T C 13: 22,102,119 M183V probably damaging Het
Vps13d G T 4: 145,178,212 Q115K probably benign Het
Zfp358 A G 8: 3,495,493 D25G probably damaging Het
Zfp521 T G 18: 13,844,590 K922T probably damaging Het
Zfp521 T A 18: 13,844,591 K922* probably null Het
Zfp68 T A 5: 138,616,481 K4* probably null Het
Other mutations in Igfbp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Igfbp7 APN 5 77352037 splice site probably benign
IGL01528:Igfbp7 APN 5 77351332 missense probably damaging 1.00
IGL02964:Igfbp7 APN 5 77351341 missense possibly damaging 0.65
IGL03223:Igfbp7 APN 5 77349471 utr 3 prime probably benign
R0403:Igfbp7 UTSW 5 77355591 missense probably benign 0.36
R0639:Igfbp7 UTSW 5 77351980 missense probably damaging 1.00
R4647:Igfbp7 UTSW 5 77351296 missense possibly damaging 0.93
R4945:Igfbp7 UTSW 5 77351257 missense probably benign 0.44
R4970:Igfbp7 UTSW 5 77407761 missense possibly damaging 0.83
R7095:Igfbp7 UTSW 5 77401490 missense probably benign 0.28
R7332:Igfbp7 UTSW 5 77351956 missense probably damaging 1.00
R7751:Igfbp7 UTSW 5 77351287 missense probably damaging 1.00
R8243:Igfbp7 UTSW 5 77401492 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGTTAGCCATCAACTCCTCC -3'
(R):5'- ATCCAGCCACCTTATGATGGAG -3'

Sequencing Primer
(F):5'- TCCCTCCCGCGGGTCTC -3'
(R):5'- ACCTTATGATGGAGCGGCC -3'
Posted On 2015-10-21