Mutagenetix > Incidental Mutations

Incidental Mutation 'R4688:Lrp6'

353855

Institutional Source

Beutler Lab

Gene Symbol

Lrp6

Ensembl Gene

ENSMUSG00000030201

Gene Name

low density lipoprotein receptor-related protein 6

Synonyms

skax26, Cd, ska26, ska

MMRRC Submission

041939-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R4688 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134446476-134566965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 134479743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 853 (R853S)

Ref Sequence

ENSEMBL: ENSMUSP00000032322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032322]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000032322
AA Change: R853S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: R853S

Domain	Start	End	E-Value	Type
LY	43	85	1.55e-2	SMART
LY	87	129	1.91e-11	SMART
LY	130	173	5.19e-13	SMART
LY	174	216	1.39e-13	SMART
LY	217	258	2.87e-6	SMART
EGF	285	324	2.16e-1	SMART
low complexity region	330	341	N/A	INTRINSIC
LY	352	394	1.29e-8	SMART
LY	395	437	5.73e-15	SMART
LY	438	481	1.07e-14	SMART
LY	482	524	3.07e-15	SMART
LY	525	565	4.66e-6	SMART
EGF	591	628	1.47e-3	SMART
LY	654	696	2.06e-7	SMART
LY	697	739	3.73e-14	SMART
LY	740	783	3.37e-12	SMART
LY	784	825	1.17e-6	SMART
LY	827	865	1.91e-2	SMART
EGF	892	930	7.35e-4	SMART
LY	957	999	1.41e-5	SMART
LY	1005	1048	5.32e-1	SMART
LY	1049	1093	5e-6	SMART
LY	1094	1136	4.25e-9	SMART
LY	1137	1177	1.91e-2	SMART
EGF	1206	1250	1.23e1	SMART
LDLa	1248	1287	2.42e-12	SMART
LDLa	1288	1324	4.37e-10	SMART
LDLa	1325	1362	1.66e-10	SMART
transmembrane domain	1371	1393	N/A	INTRINSIC
low complexity region	1429	1438	N/A	INTRINSIC
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1566	1573	N/A	INTRINSIC
low complexity region	1596	1608	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,449	S530P	probably benign	Het
1700003E16Rik	A	G	6: 83,162,698	N535S	probably damaging	Het
2810403A07Rik	T	A	3: 88,686,517	M71K	probably damaging	Het
9930021J03Rik	A	G	19: 29,717,101	I1664T	probably benign	Het
Abcc12	T	C	8: 86,548,694	S452G	possibly damaging	Het
Acacb	C	A	5: 114,204,763	Q897K	probably benign	Het
Acot3	C	A	12: 84,053,917	R145S	probably damaging	Het
AI314180	A	G	4: 58,840,757	V667A	probably damaging	Het
Ankrd54	A	T	15: 79,054,582	Y247N	probably damaging	Het
Arl11	G	A	14: 61,311,097	V119I	probably benign	Het
Atxn7	T	A	14: 14,089,288	M268K	probably benign	Het
Bms1	G	A	6: 118,392,706	R934C	probably damaging	Het
Ccdc129	G	A	6: 55,967,147		probably null	Het
Chrnb3	T	C	8: 27,394,119	S295P	probably damaging	Het
Cic	TCCCCC	TCCCCCCC	7: 25,291,670		probably null	Het
Cnr1	A	T	4: 33,944,571	I320F	probably benign	Het
Cntn4	C	T	6: 106,437,949	P147L	probably damaging	Het
Col24a1	G	A	3: 145,314,383	V172I	probably benign	Het
Col9a3	A	G	2: 180,607,631	D262G	probably damaging	Het
Csrnp2	A	G	15: 100,482,360	V350A	probably damaging	Het
D630045J12Rik	A	G	6: 38,196,657	V192A	possibly damaging	Het
Deptor	A	G	15: 55,208,781	M219V	probably benign	Het
Dmrtb1	A	T	4: 107,684,050	L38Q	probably damaging	Het
Dvl2	G	A	11: 70,007,518	R367Q	possibly damaging	Het
Dync1h1	T	G	12: 110,655,528	I3435S	probably damaging	Het
Eif2b3	A	G	4: 117,058,849	N218D	probably benign	Het
Epha2	A	G	4: 141,318,981	D497G	probably benign	Het
Epha7	G	T	4: 28,821,367	L177F	probably damaging	Het
Fam214b	A	G	4: 43,034,663	F352S	probably damaging	Het
Fam98c	C	T	7: 29,155,241	E147K	probably damaging	Het
Fbxo17	A	G	7: 28,732,554	T19A	probably benign	Het
Fbxo47	A	G	11: 97,856,223	F339S	probably damaging	Het
Frmd4a	G	T	2: 4,537,311	V234L	possibly damaging	Het
Gal3st2	A	G	1: 93,872,523	D32G	probably damaging	Het
Gpr135	T	C	12: 72,070,946	T16A	probably benign	Het
Gpr160	A	T	3: 30,896,686	R302S	probably benign	Het
Hrh2	C	A	13: 54,214,801	N265K	probably benign	Het
Htatip2	C	A	7: 49,773,423	A242E	probably damaging	Het
Igfbp7	T	C	5: 77,407,635	Y127C	probably damaging	Het
Igkv16-104	A	G	6: 68,425,894	Q57R	possibly damaging	Het
Ino80c	A	G	18: 24,108,846	S161P	probably damaging	Het
Kcnc1	A	G	7: 46,397,835	D53G	probably benign	Het
Lce1h	G	T	3: 92,763,567	R93S	unknown	Het
Lce1k	T	C	3: 92,806,644	S78G	unknown	Het
Lhcgr	T	A	17: 88,765,152	I156F	probably damaging	Het
Lpl	T	C	8: 68,899,425	Y343H	probably damaging	Het
Lrrc7	A	G	3: 158,148,605	V1322A	probably damaging	Het
Lrrc74a	C	T	12: 86,737,698	Q67*	probably null	Het
Megf6	A	T	4: 154,253,814	D447V	probably damaging	Het
Mep1a	T	C	17: 43,482,248	D355G	possibly damaging	Het
Ncoa1	T	C	12: 4,315,781	D95G	probably benign	Het
Npepl1	A	T	2: 174,114,442	I139F	possibly damaging	Het
Nrcam	T	C	12: 44,547,237	S262P	probably benign	Het
Nrp1	A	G	8: 128,502,566	N842D	probably benign	Het
Olfml3	A	G	3: 103,732,181		probably benign	Het
Olfr1375	A	G	11: 51,048,988	R294G	probably damaging	Het
Olfr1505	A	T	19: 13,919,241	T74S	probably benign	Het
Olfr32	T	A	2: 90,138,999	N47Y	possibly damaging	Het
Olfr421-ps1	T	C	1: 174,151,596	Y27H	possibly damaging	Het
Olfr711	T	A	7: 106,971,861	Y161F	probably benign	Het
Olfr773	G	A	10: 129,186,645	P259S	probably damaging	Het
Olfr918	A	G	9: 38,673,363	L27P	probably damaging	Het
Pde2a	A	G	7: 101,502,834	N316S	probably benign	Het
Pde4dip	T	A	3: 97,843,677	R74*	probably null	Het
Pex13	A	T	11: 23,655,472	W253R	possibly damaging	Het
Piezo1	A	T	8: 122,488,539	W1444R	probably damaging	Het
Pla2g4e	T	C	2: 120,167,933	K843R	possibly damaging	Het
Plxna2	C	T	1: 194,644,445	P229L	probably damaging	Het
Prelid3b	G	T	2: 174,466,799	T131K	probably benign	Het
Pros1	T	C	16: 62,889,007		probably null	Het
Prrc2c	G	T	1: 162,697,687	P450Q	unknown	Het
Ptbp1	G	T	10: 79,856,508	V5F	possibly damaging	Het
Ptk2	T	A	15: 73,206,225	L997F	probably damaging	Het
Rims1	G	T	1: 22,479,447	S525*	probably null	Het
Sh2b3	T	A	5: 121,818,634	D318V	probably benign	Het
Slc16a13	A	T	11: 70,220,275	I88N	probably damaging	Het
Slit2	T	A	5: 48,257,003		probably null	Het
Snx10	A	G	6: 51,579,938	N67S	probably damaging	Het
Stil	A	G	4: 115,041,308	Y1045C	probably damaging	Het
Stra6	A	G	9: 58,135,076		probably null	Het
Sympk	A	G	7: 19,054,410	S1254G	probably benign	Het
Syt15	G	T	14: 34,228,054	G377V	probably damaging	Het
Taar4	A	T	10: 23,960,833	I114F	probably damaging	Het
Tcaf3	G	A	6: 42,593,366		probably null	Het
Tgm7	A	T	2: 121,094,021	N558K	probably benign	Het
Tln2	T	G	9: 67,397,653	M1L	probably benign	Het
Trim50	C	T	5: 135,367,140	T314I	probably damaging	Het
Trp53rka	A	T	2: 165,491,392	Y192*	probably null	Het
Ube3b	T	C	5: 114,393,078	V211A	probably benign	Het
Ush2a	A	G	1: 188,399,941	S787G	probably benign	Het
Vmn1r189	T	C	13: 22,102,119	M183V	probably damaging	Het
Vps13d	G	T	4: 145,178,212	Q115K	probably benign	Het
Zfp358	A	G	8: 3,495,493	D25G	probably damaging	Het
Zfp521	T	G	18: 13,844,590	K922T	probably damaging	Het
Zfp521	T	A	18: 13,844,591	K922*	probably null	Het
Zfp68	T	A	5: 138,616,481	K4*	probably null	Het

Other mutations in Lrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Lrp6	APN	6	134456090	missense	probably benign	0.17
IGL00765:Lrp6	APN	6	134541854	missense	probably benign	0.02
IGL00898:Lrp6	APN	6	134479739	missense	probably damaging	0.99
IGL00916:Lrp6	APN	6	134484289	missense	probably damaging	1.00
IGL00961:Lrp6	APN	6	134507646	missense	probably damaging	0.98
IGL01620:Lrp6	APN	6	134511262	missense	probably damaging	1.00
IGL01765:Lrp6	APN	6	134456145	missense	probably damaging	0.99
IGL02066:Lrp6	APN	6	134450937	nonsense	probably null
IGL02067:Lrp6	APN	6	134480396	missense	probably damaging	0.99
IGL02169:Lrp6	APN	6	134513327	missense	probably damaging	0.96
IGL02281:Lrp6	APN	6	134457734	missense	probably benign	0.40
IGL02484:Lrp6	APN	6	134541923	missense	probably benign	0.15
IGL02724:Lrp6	APN	6	134484265	missense	probably damaging	1.00
IGL02876:Lrp6	APN	6	134456114	missense	probably benign	0.43
IGL03011:Lrp6	APN	6	134520417	missense	possibly damaging	0.80
IGL03352:Lrp6	APN	6	134479763	missense	probably damaging	1.00
Aileron	UTSW	6	134462616	missense	probably damaging	1.00
Coiled	UTSW	6	134507558	nonsense	probably null
flap	UTSW	6	134486586	missense	probably damaging	0.99
BB004:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
BB014:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
PIT4494001:Lrp6	UTSW	6	134479778	missense	probably damaging	1.00
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0201:Lrp6	UTSW	6	134450897	nonsense	probably null
R0295:Lrp6	UTSW	6	134457693	missense	probably benign	0.02
R0370:Lrp6	UTSW	6	134479766	missense	probably damaging	1.00
R0382:Lrp6	UTSW	6	134467668	missense	probably damaging	1.00
R0413:Lrp6	UTSW	6	134507624	missense	probably damaging	0.99
R0468:Lrp6	UTSW	6	134485661	missense	possibly damaging	0.94
R0492:Lrp6	UTSW	6	134480518	missense	possibly damaging	0.58
R0584:Lrp6	UTSW	6	134456076	missense	probably damaging	0.99
R0631:Lrp6	UTSW	6	134479775	missense	possibly damaging	0.95
R0738:Lrp6	UTSW	6	134542045	missense	probably benign	0.13
R0907:Lrp6	UTSW	6	134507525	missense	probably damaging	0.96
R1273:Lrp6	UTSW	6	134467507	critical splice donor site	probably null
R1548:Lrp6	UTSW	6	134459429	missense	possibly damaging	0.89
R1639:Lrp6	UTSW	6	134453566	missense	possibly damaging	0.68
R1650:Lrp6	UTSW	6	134468769	missense	probably benign	0.01
R1696:Lrp6	UTSW	6	134468723	missense	probably damaging	1.00
R1751:Lrp6	UTSW	6	134464568	missense	probably damaging	1.00
R1780:Lrp6	UTSW	6	134464451	missense	probably damaging	0.99
R2013:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2015:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2165:Lrp6	UTSW	6	134459283	missense	probably damaging	1.00
R2294:Lrp6	UTSW	6	134457742	missense	probably damaging	1.00
R2336:Lrp6	UTSW	6	134507583	missense	probably damaging	0.97
R2964:Lrp6	UTSW	6	134467526	missense	probably damaging	1.00
R3716:Lrp6	UTSW	6	134507447	missense	probably damaging	1.00
R4017:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R4370:Lrp6	UTSW	6	134506358	nonsense	probably null
R4521:Lrp6	UTSW	6	134485862	missense	probably damaging	1.00
R4573:Lrp6	UTSW	6	134470730	nonsense	probably null
R4645:Lrp6	UTSW	6	134484250	missense	probably damaging	1.00
R4661:Lrp6	UTSW	6	134511267	missense	probably benign
R4784:Lrp6	UTSW	6	134479539	missense	probably benign	0.06
R5236:Lrp6	UTSW	6	134511264	missense	probably damaging	1.00
R5506:Lrp6	UTSW	6	134459296	missense	probably benign	0.09
R5508:Lrp6	UTSW	6	134464516	missense	probably benign	0.31
R6001:Lrp6	UTSW	6	134464518	missense	probably benign	0.03
R6319:Lrp6	UTSW	6	134541835	missense	possibly damaging	0.46
R6537:Lrp6	UTSW	6	134480495	missense	probably benign
R6552:Lrp6	UTSW	6	134454729	missense	probably benign	0.17
R6559:Lrp6	UTSW	6	134513254	missense	probably damaging	1.00
R6575:Lrp6	UTSW	6	134541971	missense	possibly damaging	0.80
R6585:Lrp6	UTSW	6	134507558	nonsense	probably null
R6700:Lrp6	UTSW	6	134479560	missense	probably damaging	1.00
R6724:Lrp6	UTSW	6	134486541	missense	possibly damaging	0.94
R7159:Lrp6	UTSW	6	134507551	missense	probably benign
R7266:Lrp6	UTSW	6	134507401	missense	probably damaging	1.00
R7339:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7341:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7342:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7348:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7359:Lrp6	UTSW	6	134450960	nonsense	probably null
R7366:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7368:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7501:Lrp6	UTSW	6	134486508	missense	probably damaging	1.00
R7548:Lrp6	UTSW	6	134507508	missense	probably damaging	0.97
R7652:Lrp6	UTSW	6	134511245	nonsense	probably null
R7771:Lrp6	UTSW	6	134462616	missense	probably damaging	1.00
R7927:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R8717:Lrp6	UTSW	6	134457748	missense	probably benign	0.41
R8726:Lrp6	UTSW	6	134507661	nonsense	probably null
R8792:Lrp6	UTSW	6	134486586	missense	probably damaging	0.99
R8812:Lrp6	UTSW	6	134456178	missense	probably benign
R8855:Lrp6	UTSW	6	134468822	missense	probably benign	0.04
R8866:Lrp6	UTSW	6	134468822	missense	probably benign	0.04
R8994:Lrp6	UTSW	6	134541693	missense	probably benign
R9021:Lrp6	UTSW	6	134541967	missense	probably benign	0.00
R9089:Lrp6	UTSW	6	134511206	missense	probably damaging	0.97
R9154:Lrp6	UTSW	6	134541892	missense	probably damaging	1.00
R9263:Lrp6	UTSW	6	134480504	missense	probably damaging	1.00
R9287:Lrp6	UTSW	6	134506296	missense	probably benign	0.21
Z1176:Lrp6	UTSW	6	134456157	missense	possibly damaging	0.72
Z1177:Lrp6	UTSW	6	134462541	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCATTCAGGGAGTAGTGG -3'
(R):5'- AGTCAGACTACGCATGGACTAC -3'

Sequencing Primer
(F):5'- AGTAGTGGGCAGGGCATCC -3'
(R):5'- GATGACTTGCCTCATCCT -3'

Posted On

2015-10-21