Incidental Mutation 'R4698:Eef1g'
ID 355870
Institutional Source Beutler Lab
Gene Symbol Eef1g
Ensembl Gene ENSMUSG00000071644
Gene Name eukaryotic translation elongation factor 1 gamma
Synonyms 2610301D06Rik, EF1G
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R4698 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 8944405-8955544 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8955330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 393 (D393G)
Ref Sequence ENSEMBL: ENSMUSP00000093955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052248]
AlphaFold Q9D8N0
Predicted Effect possibly damaging
Transcript: ENSMUST00000052248
AA Change: D393G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093955
Gene: ENSMUSG00000071644
AA Change: D393G

DomainStartEndE-ValueType
Pfam:GST_N 2 81 1.5e-25 PFAM
Pfam:GST_N_3 6 83 1.4e-8 PFAM
Pfam:GST_C_3 88 194 8.3e-13 PFAM
Pfam:GST_C 106 198 4.5e-22 PFAM
Pfam:GST_C_2 125 191 8.6e-12 PFAM
low complexity region 238 262 N/A INTRINSIC
EF1G 275 381 3.63e-78 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135025
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit contains an N-terminal glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing this elongation factor and aminoacyl-tRNA synthetases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,349,049 (GRCm39) V11A possibly damaging Het
6030452D12Rik T C 8: 107,230,979 (GRCm39) I55T unknown Het
Aadacl2 A G 3: 59,932,460 (GRCm39) D325G probably benign Het
Adh1 A G 3: 137,988,274 (GRCm39) S113G probably benign Het
Agxt2 T C 15: 10,392,130 (GRCm39) probably null Het
Aicda C T 6: 122,530,847 (GRCm39) probably benign Het
Aifm2 T C 10: 61,563,535 (GRCm39) M135T probably benign Het
Asah2 T C 19: 32,031,871 (GRCm39) probably null Het
Btbd17 T C 11: 114,682,543 (GRCm39) R390G probably damaging Het
Cadps T C 14: 12,705,654 (GRCm38) E247G possibly damaging Het
Cds2 T C 2: 132,146,873 (GRCm39) I383T probably damaging Het
Celf3 T A 3: 94,392,174 (GRCm39) probably null Het
Crhr2 T C 6: 55,079,852 (GRCm39) S162G possibly damaging Het
Dapl1 A T 2: 59,335,118 (GRCm39) K91* probably null Het
Ddx60 A C 8: 62,465,458 (GRCm39) M1372L probably benign Het
Dnah2 A T 11: 69,389,358 (GRCm39) F845I probably damaging Het
Dscam T C 16: 96,411,524 (GRCm39) D1784G probably damaging Het
Ech1 T C 7: 28,531,478 (GRCm39) V310A probably benign Het
Eif3k T C 7: 28,671,969 (GRCm39) I172V possibly damaging Het
Foxd4 A G 19: 24,877,625 (GRCm39) F192L probably damaging Het
Gpr153 T A 4: 152,366,240 (GRCm39) S268R probably damaging Het
H3c13 C A 3: 96,176,394 (GRCm39) R129S probably damaging Het
Ivl T C 3: 92,478,698 (GRCm39) K456E unknown Het
Kif20b A T 19: 34,928,944 (GRCm39) D1190V probably damaging Het
Kif21a T A 15: 90,840,508 (GRCm39) I1223L possibly damaging Het
Lmf1 T C 17: 25,798,324 (GRCm39) V55A probably damaging Het
Loxhd1 A G 18: 77,459,987 (GRCm39) E659G possibly damaging Het
Lrrc37a T C 11: 103,394,930 (GRCm39) E165G possibly damaging Het
Mios T C 6: 8,228,113 (GRCm39) Y677H possibly damaging Het
Mnx1 T A 5: 29,679,057 (GRCm39) K342M unknown Het
Mtpap A T 18: 4,375,724 (GRCm39) T35S possibly damaging Het
Ndc1 C G 4: 107,268,334 (GRCm39) D623E probably benign Het
Nedd4l A G 18: 65,336,951 (GRCm39) Y666C probably damaging Het
Or52s6 T A 7: 103,091,842 (GRCm39) I163F possibly damaging Het
Or5ac22 T C 16: 59,135,720 (GRCm39) T17A probably damaging Het
Or5b12b T G 19: 12,861,985 (GRCm39) F247V probably benign Het
Or5m10b A G 2: 85,699,596 (GRCm39) Y220C possibly damaging Het
Papss1 G T 3: 131,313,092 (GRCm39) V369F probably damaging Het
Pcdhac2 T A 18: 37,278,822 (GRCm39) Y601N probably damaging Het
Pde7a C T 3: 19,365,095 (GRCm39) R24Q probably damaging Het
Phf21a A G 2: 92,187,297 (GRCm39) D445G probably damaging Het
Plekho1 T A 3: 95,902,964 (GRCm39) N15I possibly damaging Het
Pprc1 T C 19: 46,057,634 (GRCm39) probably benign Het
Ralgapa1 A T 12: 55,724,061 (GRCm39) probably null Het
Rrp12 T C 19: 41,861,481 (GRCm39) E942G probably benign Het
Skor1 T C 9: 63,051,830 (GRCm39) D685G probably benign Het
Smim23 A T 11: 32,774,510 (GRCm39) I3N possibly damaging Het
Spata7 A T 12: 98,630,536 (GRCm39) I333F probably damaging Het
Sppl2c T C 11: 104,079,141 (GRCm39) I647T probably benign Het
Srgap1 C A 10: 121,628,392 (GRCm39) R837L probably benign Het
Stpg2 C A 3: 139,014,990 (GRCm39) P385H probably damaging Het
Tmem238 C A 7: 4,792,016 (GRCm39) E19* probably null Het
Top2b A T 14: 16,387,331 (GRCm38) K140* probably null Het
Trp53 T A 11: 69,479,248 (GRCm39) L142* probably null Het
Tyro3 A T 2: 119,633,751 (GRCm39) D133V probably damaging Het
Virma T A 4: 11,528,636 (GRCm39) I1291N probably damaging Het
Vmn1r213 A G 13: 23,195,507 (GRCm39) probably benign Het
Zbtb10 T C 3: 9,329,610 (GRCm39) S323P possibly damaging Het
Zfp521 A T 18: 13,978,660 (GRCm39) N584K probably damaging Het
Zfp944 A G 17: 22,558,180 (GRCm39) C356R probably damaging Het
Other mutations in Eef1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0577:Eef1g UTSW 19 8,950,406 (GRCm39) missense probably benign 0.02
R1871:Eef1g UTSW 19 8,955,330 (GRCm39) missense possibly damaging 0.80
R3946:Eef1g UTSW 19 8,947,341 (GRCm39) missense probably benign 0.23
R6112:Eef1g UTSW 19 8,954,955 (GRCm39) missense probably damaging 1.00
R6672:Eef1g UTSW 19 8,944,411 (GRCm39) splice site probably null
R6944:Eef1g UTSW 19 8,945,656 (GRCm39) missense probably benign
R7665:Eef1g UTSW 19 8,945,653 (GRCm39) missense probably benign 0.19
R7725:Eef1g UTSW 19 8,955,427 (GRCm39) missense probably benign 0.00
R7836:Eef1g UTSW 19 8,954,738 (GRCm39) missense probably benign 0.10
R9139:Eef1g UTSW 19 8,955,383 (GRCm39) missense probably benign
R9613:Eef1g UTSW 19 8,955,018 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGGCCAGTGGGTATGAAG -3'
(R):5'- CAAGGATGTCTCAGGCATCG -3'

Sequencing Primer
(F):5'- CCAGTGGGTATGAAGGAAGAATTCTG -3'
(R):5'- TCTCAGGCATCGGCAAAAACTTTG -3'
Posted On 2015-10-21