Mutagenetix > Incidental Mutation

Incidental Mutation 'R7922:Apaf1'

648460

Institutional Source

Beutler Lab

Gene Symbol

Apaf1

Ensembl Gene

ENSMUSG00000019979

Gene Name

apoptotic peptidase activating factor 1

Synonyms

Apaf1l, 6230400I06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7922 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90989311-91082770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90999753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1077 (I1077V)

Ref Sequence

ENSEMBL: ENSMUSP00000020157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]

AlphaFold

O88879

Predicted Effect

probably benign
Transcript: ENSMUST00000020157
AA Change: I1077V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: I1077V

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.3e-22	PFAM
Pfam:NB-ARC	129	414	1.7e-77	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000159110
AA Change: I1077V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: I1077V

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.4e-21	PFAM
Pfam:NB-ARC	129	414	6.9e-71	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000162618
AA Change: I1066V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: I1066V

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	1.1e-20	PFAM
Pfam:NB-ARC	118	403	8.8e-72	PFAM
WD40	593	632	1.35e-5	SMART
WD40	635	674	1.04e-11	SMART
WD40	677	718	2.98e-7	SMART
WD40	721	760	9.88e-13	SMART
WD40	769	814	1.28e1	SMART
WD40	817	857	1.43e0	SMART
WD40	860	899	3.24e-8	SMART
WD40	941	978	2.57e0	SMART
WD40	981	1020	1.09e-5	SMART
WD40	1022	1060	2.09e-2	SMART
WD40	1063	1102	2.93e-6	SMART
WD40	1105	1144	8.55e-8	SMART
WD40	1157	1193	4.55e-3	SMART
Blast:WD40	1196	1235	5e-18	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	C	T	12: 71,164,406	T638M	possibly damaging	Het
4930546C10Rik	A	G	18: 68,949,996		probably null	Het
Abi3	A	T	11: 95,832,793	Y342N	unknown	Het
Adk	G	A	14: 21,318,043	V195I	probably benign	Het
Ago2	C	T	15: 73,126,526	V268M	possibly damaging	Het
Arap1	A	T	7: 101,404,414	K1317*	probably null	Het
Auts2	T	A	5: 131,440,373	D493V		Het
Baz1b	A	T	5: 135,231,679	Q1110L	probably damaging	Het
Brsk2	T	A	7: 141,993,220	S467T	possibly damaging	Het
Btbd9	A	T	17: 30,274,884	M511K	probably benign	Het
Cdh23	T	A	10: 60,382,706	Y1385F	probably benign	Het
Cfap100	A	C	6: 90,403,980	L427V	unknown	Het
Cnga1	A	G	5: 72,604,882	F430L	possibly damaging	Het
Dnhd1	A	T	7: 105,668,514	D472V	probably damaging	Het
Dock2	T	A	11: 34,707,327	E339V	probably benign	Het
Eif3a	A	T	19: 60,775,842	V379E	probably damaging	Het
Erich4	T	A	7: 25,615,743	N36Y	probably damaging	Het
Fam60a	T	A	6: 148,926,146	T125S	probably benign	Het
Frem2	T	C	3: 53,653,304	T1261A	probably damaging	Het
Fzd6	A	T	15: 39,031,108	D223V	probably damaging	Het
Gabra2	A	T	5: 71,007,972	Y218*	probably null	Het
Gcn1l1	G	T	5: 115,614,468	M2177I	probably benign	Het
Ghr	G	A	15: 3,341,074	T103I	possibly damaging	Het
Gipc1	T	C	8: 83,661,228	V79A	probably benign	Het
Gm10031	A	T	1: 156,524,992	L254F	probably damaging	Het
Gm13272	T	A	4: 88,780,340	V164D	probably damaging	Het
Gramd4	C	A	15: 86,131,958	H503Q	probably benign	Het
Gstm4	A	T	3: 108,044,671	M1K	probably null	Het
Heatr5b	T	A	17: 78,760,559	Q1800L	probably benign	Het
Hectd1	T	A	12: 51,790,195	K826*	probably null	Het
Hoxa9	T	C	6: 52,224,309	I251V	possibly damaging	Het
Il2ra	A	T	2: 11,674,366	I46F	possibly damaging	Het
Ints2	T	A	11: 86,244,627	R320S	probably benign	Het
Iscu	A	T	5: 113,774,282	N46I	probably damaging	Het
Iscu	G	A	5: 113,774,349	R60Q	unknown	Het
Kcnk3	A	T	5: 30,588,531	H72L	probably damaging	Het
Kmt2a	T	G	9: 44,842,860	S1228R	unknown	Het
Mbl2	T	A	19: 30,239,238	L150Q	probably damaging	Het
Med13	A	T	11: 86,271,005	F2166Y	probably damaging	Het
Mterf4	A	C	1: 93,301,553	L246*	probably null	Het
Muc16	T	C	9: 18,584,825	Q6690R	probably benign	Het
Myh10	T	A	11: 68,808,893	L1722Q	possibly damaging	Het
Neurod2	T	C	11: 98,327,628	M237V	probably benign	Het
Olfml1	A	G	7: 107,571,149	Y81C	probably damaging	Het
Olfr735	A	G	14: 50,346,415	V9A	probably benign	Het
Pcdhga7	A	T	18: 37,716,173	N411I	probably benign	Het
Pcdhgb8	T	C	18: 37,763,949	F691L	probably benign	Het
Pik3c2a	A	G	7: 116,391,282	V481A	probably damaging	Het
Pik3r6	A	T	11: 68,533,875	R435S	probably benign	Het
Pkd1l1	G	A	11: 8,849,013	H2250Y		Het
Pkd1l1	A	G	11: 8,909,857	S1034P		Het
Plcd1	C	A	9: 119,074,652	R400L	possibly damaging	Het
Ppp2r1a	A	G	17: 20,954,617	T58A	probably benign	Het
Ppp5c	T	C	7: 17,027,800	E5G	possibly damaging	Het
Pradc1	A	C	6: 85,447,968	F82L	probably benign	Het
Prkag3	A	T	1: 74,741,257	S416R	probably benign	Het
Rab3gap2	T	C	1: 185,249,920	C390R	probably benign	Het
Rhot1	A	G	11: 80,265,803	T655A	probably benign	Het
Rorc	A	G	3: 94,391,188	I348V	probably damaging	Het
Ryr1	A	T	7: 29,097,224	V1051E	probably benign	Het
Sema5b	GCAC	GC	16: 35,658,256		probably null	Het
Serpinb3c	G	A	1: 107,272,014	T259I	probably damaging	Het
Sh3gl1	A	T	17: 56,019,438	M70K	probably damaging	Het
Slc7a4	C	T	16: 17,573,366	V607I	probably benign	Het
Spop	A	T	11: 95,471,328	N62Y	probably damaging	Het
Spout1	A	G	2: 30,176,811	F130S	probably benign	Het
Tab1	A	G	15: 80,158,865	H420R	possibly damaging	Het
Tecpr2	CA	C	12: 110,932,642		probably null	Het
Tnxb	G	C	17: 34,714,603	K2332N	probably damaging	Het
Togaram1	T	C	12: 64,967,738	Y588H	probably damaging	Het
Trim71	G	A	9: 114,513,085	R710C	probably damaging	Het
Tsen54	C	T	11: 115,820,782	Q342*	probably null	Het
Ube2r2	T	A	4: 41,190,812	N235K	unknown	Het
Utrn	C	A	10: 12,667,527	K1792N	possibly damaging	Het
Vmn1r122	A	G	7: 21,133,662	I156T	possibly damaging	Het
Vmn1r94	T	C	7: 20,167,711	T223A	possibly damaging	Het
Vmn2r120	G	A	17: 57,524,683	R369W	probably damaging	Het
Vwa7	G	T	17: 35,024,433	A717S	possibly damaging	Het
Zc3h4	T	A	7: 16,425,722	C398S	unknown	Het
Zc3hc1	T	A	6: 30,390,875	E43V	possibly damaging	Het
Zfp101	A	T	17: 33,381,537	V415D	possibly damaging	Het
Zfp553	A	G	7: 127,236,596	H441R	probably damaging	Het

Other mutations in Apaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Apaf1	APN	10	91023788	missense	probably damaging	0.99
IGL00819:Apaf1	APN	10	90997340	splice site	probably null
IGL01481:Apaf1	APN	10	91031588	missense	possibly damaging	0.84
IGL01713:Apaf1	APN	10	91061832	splice site	probably benign
IGL01715:Apaf1	APN	10	91058354	missense	probably benign	0.20
IGL02152:Apaf1	APN	10	91061819	missense	probably benign	0.24
IGL02331:Apaf1	APN	10	91059619	missense	probably damaging	1.00
IGL03071:Apaf1	APN	10	90997255	missense	possibly damaging	0.88
IGL03101:Apaf1	APN	10	91031559	missense	possibly damaging	0.89
IGL03244:Apaf1	APN	10	91049349	splice site	probably benign
Bedlam	UTSW	10	91060271	missense	probably damaging	0.99
Mayhem	UTSW	10	90999719	missense	probably damaging	0.99
Wipeout	UTSW	10	91056000	missense	probably damaging	1.00
R0520:Apaf1	UTSW	10	91079989	missense	probably damaging	0.99
R0600:Apaf1	UTSW	10	91060052	missense	probably damaging	1.00
R0607:Apaf1	UTSW	10	91009203	missense	probably damaging	1.00
R0688:Apaf1	UTSW	10	91061705	missense	possibly damaging	0.94
R0734:Apaf1	UTSW	10	91037021	missense	probably benign	0.02
R1256:Apaf1	UTSW	10	91058406	missense	probably benign
R1459:Apaf1	UTSW	10	91062160	missense	probably benign	0.00
R1485:Apaf1	UTSW	10	91060243	missense	probably benign	0.02
R1511:Apaf1	UTSW	10	91060185	missense	possibly damaging	0.81
R1531:Apaf1	UTSW	10	91054521	missense	probably damaging	1.00
R1705:Apaf1	UTSW	10	91067271	splice site	probably benign
R1919:Apaf1	UTSW	10	91077614	nonsense	probably null
R1925:Apaf1	UTSW	10	90999719	missense	probably damaging	0.99
R2001:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2002:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2006:Apaf1	UTSW	10	91061772	missense	probably damaging	1.00
R2043:Apaf1	UTSW	10	91037028	missense	probably damaging	1.00
R2073:Apaf1	UTSW	10	91031694	nonsense	probably null
R2101:Apaf1	UTSW	10	91060080	missense	probably benign	0.26
R2130:Apaf1	UTSW	10	91060165	nonsense	probably null
R2153:Apaf1	UTSW	10	91048090	missense	probably damaging	1.00
R2377:Apaf1	UTSW	10	91079893	missense	possibly damaging	0.95
R2421:Apaf1	UTSW	10	91020723	missense	probably damaging	1.00
R3835:Apaf1	UTSW	10	91059587	missense	probably benign	0.07
R4750:Apaf1	UTSW	10	91060188	missense	probably damaging	1.00
R5100:Apaf1	UTSW	10	90997287	missense	probably benign
R5135:Apaf1	UTSW	10	91060094	missense	probably damaging	1.00
R5497:Apaf1	UTSW	10	90999656	missense	probably damaging	1.00
R5511:Apaf1	UTSW	10	91054392	missense	probably damaging	1.00
R5659:Apaf1	UTSW	10	91062153	nonsense	probably null
R5730:Apaf1	UTSW	10	91020771	missense	possibly damaging	0.62
R6176:Apaf1	UTSW	10	91059571	critical splice donor site	probably null
R6242:Apaf1	UTSW	10	91062163	missense	probably damaging	1.00
R6292:Apaf1	UTSW	10	90991563	missense	possibly damaging	0.86
R6376:Apaf1	UTSW	10	91023811	missense	probably damaging	1.00
R6534:Apaf1	UTSW	10	91056000	missense	probably damaging	1.00
R6975:Apaf1	UTSW	10	91020734	missense	probably damaging	0.97
R7218:Apaf1	UTSW	10	91037002	missense	probably damaging	1.00
R7369:Apaf1	UTSW	10	91001036	missense	probably damaging	0.97
R7409:Apaf1	UTSW	10	91067246	missense	probably damaging	1.00
R7413:Apaf1	UTSW	10	90995680	missense	probably benign	0.28
R7418:Apaf1	UTSW	10	91023835	missense	probably benign	0.09
R7423:Apaf1	UTSW	10	91059606	missense	probably damaging	1.00
R7488:Apaf1	UTSW	10	91054380	missense	probably benign	0.35
R7765:Apaf1	UTSW	10	91023782	missense	probably benign	0.34
R7913:Apaf1	UTSW	10	91060271	missense	probably damaging	0.99
R7914:Apaf1	UTSW	10	91060233	missense	probably damaging	1.00
R8131:Apaf1	UTSW	10	91077558	missense	possibly damaging	0.93
R8158:Apaf1	UTSW	10	91059658	missense	probably benign	0.05
R8673:Apaf1	UTSW	10	90995668	missense	probably damaging	1.00
R8682:Apaf1	UTSW	10	90995670	missense	probably damaging	1.00
R8962:Apaf1	UTSW	10	91067204	missense	probably damaging	1.00
R9069:Apaf1	UTSW	10	91023718	critical splice donor site	probably null
R9200:Apaf1	UTSW	10	91009240	missense	probably benign	0.24
R9516:Apaf1	UTSW	10	91079954	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACCAAATCTGTGACTATCTTGCC -3'
(R):5'- GGGCTTTGCACTCACTAAAC -3'

Sequencing Primer
(F):5'- ATCTTGCCTTATACATTGTTTGGAC -3'
(R):5'- TCTACCAGTAAGTGACATCCTTTG -3'

Posted On

2020-09-15