Incidental Mutation 'R7922:Apaf1'
ID648460
Institutional Source Beutler Lab
Gene Symbol Apaf1
Ensembl Gene ENSMUSG00000019979
Gene Nameapoptotic peptidase activating factor 1
SynonymsApaf1l, 6230400I06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location90989311-91082770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90999753 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1077 (I1077V)
Ref Sequence ENSEMBL: ENSMUSP00000020157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]
Predicted Effect probably benign
Transcript: ENSMUST00000020157
AA Change: I1077V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: I1077V

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.3e-22 PFAM
Pfam:NB-ARC 129 414 1.7e-77 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159110
AA Change: I1077V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: I1077V

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.4e-21 PFAM
Pfam:NB-ARC 129 414 6.9e-71 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162618
AA Change: I1066V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: I1066V

DomainStartEndE-ValueType
Pfam:CARD 6 90 1.1e-20 PFAM
Pfam:NB-ARC 118 403 8.8e-72 PFAM
WD40 593 632 1.35e-5 SMART
WD40 635 674 1.04e-11 SMART
WD40 677 718 2.98e-7 SMART
WD40 721 760 9.88e-13 SMART
WD40 769 814 1.28e1 SMART
WD40 817 857 1.43e0 SMART
WD40 860 899 3.24e-8 SMART
WD40 941 978 2.57e0 SMART
WD40 981 1020 1.09e-5 SMART
WD40 1022 1060 2.09e-2 SMART
WD40 1063 1102 2.93e-6 SMART
WD40 1105 1144 8.55e-8 SMART
WD40 1157 1193 4.55e-3 SMART
Blast:WD40 1196 1235 5e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Apaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Apaf1 APN 10 91023788 missense probably damaging 0.99
IGL00819:Apaf1 APN 10 90997340 splice site probably null
IGL01481:Apaf1 APN 10 91031588 missense possibly damaging 0.84
IGL01713:Apaf1 APN 10 91061832 splice site probably benign
IGL01715:Apaf1 APN 10 91058354 missense probably benign 0.20
IGL02152:Apaf1 APN 10 91061819 missense probably benign 0.24
IGL02331:Apaf1 APN 10 91059619 missense probably damaging 1.00
IGL03071:Apaf1 APN 10 90997255 missense possibly damaging 0.88
IGL03101:Apaf1 APN 10 91031559 missense possibly damaging 0.89
IGL03244:Apaf1 APN 10 91049349 splice site probably benign
Mayhem UTSW 10 90999719 missense probably damaging 0.99
Wipeout UTSW 10 91056000 missense probably damaging 1.00
R0520:Apaf1 UTSW 10 91079989 missense probably damaging 0.99
R0600:Apaf1 UTSW 10 91060052 missense probably damaging 1.00
R0607:Apaf1 UTSW 10 91009203 missense probably damaging 1.00
R0688:Apaf1 UTSW 10 91061705 missense possibly damaging 0.94
R0734:Apaf1 UTSW 10 91037021 missense probably benign 0.02
R1256:Apaf1 UTSW 10 91058406 missense probably benign
R1459:Apaf1 UTSW 10 91062160 missense probably benign 0.00
R1485:Apaf1 UTSW 10 91060243 missense probably benign 0.02
R1511:Apaf1 UTSW 10 91060185 missense possibly damaging 0.81
R1531:Apaf1 UTSW 10 91054521 missense probably damaging 1.00
R1705:Apaf1 UTSW 10 91067271 splice site probably benign
R1919:Apaf1 UTSW 10 91077614 nonsense probably null
R1925:Apaf1 UTSW 10 90999719 missense probably damaging 0.99
R2001:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2002:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2006:Apaf1 UTSW 10 91061772 missense probably damaging 1.00
R2043:Apaf1 UTSW 10 91037028 missense probably damaging 1.00
R2073:Apaf1 UTSW 10 91031694 nonsense probably null
R2101:Apaf1 UTSW 10 91060080 missense probably benign 0.26
R2130:Apaf1 UTSW 10 91060165 nonsense probably null
R2153:Apaf1 UTSW 10 91048090 missense probably damaging 1.00
R2377:Apaf1 UTSW 10 91079893 missense possibly damaging 0.95
R2421:Apaf1 UTSW 10 91020723 missense probably damaging 1.00
R3835:Apaf1 UTSW 10 91059587 missense probably benign 0.07
R4750:Apaf1 UTSW 10 91060188 missense probably damaging 1.00
R5100:Apaf1 UTSW 10 90997287 missense probably benign
R5135:Apaf1 UTSW 10 91060094 missense probably damaging 1.00
R5497:Apaf1 UTSW 10 90999656 missense probably damaging 1.00
R5511:Apaf1 UTSW 10 91054392 missense probably damaging 1.00
R5659:Apaf1 UTSW 10 91062153 nonsense probably null
R5730:Apaf1 UTSW 10 91020771 missense possibly damaging 0.62
R6176:Apaf1 UTSW 10 91059571 critical splice donor site probably null
R6242:Apaf1 UTSW 10 91062163 missense probably damaging 1.00
R6292:Apaf1 UTSW 10 90991563 missense possibly damaging 0.86
R6376:Apaf1 UTSW 10 91023811 missense probably damaging 1.00
R6534:Apaf1 UTSW 10 91056000 missense probably damaging 1.00
R6975:Apaf1 UTSW 10 91020734 missense probably damaging 0.97
R7218:Apaf1 UTSW 10 91037002 missense probably damaging 1.00
R7369:Apaf1 UTSW 10 91001036 missense probably damaging 0.97
R7409:Apaf1 UTSW 10 91067246 missense probably damaging 1.00
R7413:Apaf1 UTSW 10 90995680 missense probably benign 0.28
R7418:Apaf1 UTSW 10 91023835 missense probably benign 0.09
R7423:Apaf1 UTSW 10 91059606 missense probably damaging 1.00
R7488:Apaf1 UTSW 10 91054380 missense probably benign 0.35
R7765:Apaf1 UTSW 10 91023782 missense probably benign 0.34
R7913:Apaf1 UTSW 10 91060271 missense probably damaging 0.99
R7914:Apaf1 UTSW 10 91060233 missense probably damaging 1.00
R8131:Apaf1 UTSW 10 91077558 missense possibly damaging 0.93
R8158:Apaf1 UTSW 10 91059658 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAACCAAATCTGTGACTATCTTGCC -3'
(R):5'- GGGCTTTGCACTCACTAAAC -3'

Sequencing Primer
(F):5'- ATCTTGCCTTATACATTGTTTGGAC -3'
(R):5'- TCTACCAGTAAGTGACATCCTTTG -3'
Posted On2020-09-15