Mutagenetix > Incidental Mutations

Incidental Mutation 'R0411:Tns1'

36630

Institutional Source

Beutler Lab

Gene Symbol

Tns1

Ensembl Gene

ENSMUSG00000055322

Gene Name

tensin 1

Synonyms

1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns

MMRRC Submission

038613-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R0411 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

73910231-74124449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 73925761 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1237 (V1237E)

Ref Sequence

ENSEMBL: ENSMUSP00000148638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000187691] [ENSMUST00000191104] [ENSMUST00000212888]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169786
AA Change: V1245E

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: V1245E

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	1.77e-2	SMART
low complexity region	154	167	N/A	INTRINSIC
SCOP:d1d5ra2	176	348	3e-32	SMART
PTEN_C2	350	477	1.12e-51	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1227	1239	N/A	INTRINSIC
low complexity region	1284	1300	N/A	INTRINSIC
low complexity region	1459	1470	N/A	INTRINSIC
low complexity region	1518	1530	N/A	INTRINSIC
SH2	1614	1716	6.85e-17	SMART
PTB	1747	1888	1.69e-29	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185264

Predicted Effect

unknown
Transcript: ENSMUST00000185331
AA Change: V1062E

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185529

Predicted Effect

unknown
Transcript: ENSMUST00000185702
AA Change: V1075E

Predicted Effect

possibly damaging
Transcript: ENSMUST00000187584
AA Change: V1180E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: V1180E

Domain	Start	End	E-Value	Type
C1	21	67	8.6e-5	SMART
low complexity region	113	124	N/A	INTRINSIC
PTPc_DSPc	197	319	9.9e-6	SMART
PTEN_C2	306	433	5.6e-56	SMART
low complexity region	778	789	N/A	INTRINSIC
low complexity region	861	878	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1219	1235	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1453	1465	N/A	INTRINSIC
SH2	1549	1651	4.3e-19	SMART
PTB	1682	1823	9e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187691

SMART Domains

Protein: ENSMUSP00000139844
Gene: ENSMUSG00000055322

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	195	206	N/A	INTRINSIC
low complexity region	254	266	N/A	INTRINSIC
SH2	350	452	4.3e-19	SMART
PTB	483	624	9e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189228

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191104
AA Change: V1224E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: V1224E

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	8.6e-5	SMART
low complexity region	154	167	N/A	INTRINSIC
PTPc_DSPc	241	363	9.9e-6	SMART
PTEN_C2	350	477	5.6e-56	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1206	1218	N/A	INTRINSIC
low complexity region	1263	1279	N/A	INTRINSIC
low complexity region	1438	1449	N/A	INTRINSIC
low complexity region	1497	1509	N/A	INTRINSIC
SH2	1593	1695	4.3e-19	SMART
PTB	1726	1867	9e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191527

Predicted Effect

probably damaging
Transcript: ENSMUST00000212888
AA Change: V1237E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.0982

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	A	G	5: 63,896,491		probably benign	Het
6030469F06Rik	A	T	12: 31,184,731		noncoding transcript	Het
Acad11	T	C	9: 104,116,296	F541L	probably damaging	Het
Acin1	G	T	14: 54,646,774	R92S	probably damaging	Het
Appl1	A	G	14: 26,940,256	S490P	probably benign	Het
Aqp9	C	A	9: 71,130,444	V184L	probably benign	Het
Arih1	A	T	9: 59,485,983	I122N	possibly damaging	Het
Bmi1	T	C	2: 18,683,172		probably benign	Het
Bmpr1a	G	A	14: 34,415,877	T391I	possibly damaging	Het
Cacna1s	A	G	1: 136,113,303	K1256E	probably damaging	Het
Cacng3	C	T	7: 122,768,572	P225L	probably damaging	Het
Cd101	A	T	3: 101,018,527		probably null	Het
Cd55	A	G	1: 130,462,557		probably benign	Het
Cenpe	T	C	3: 135,222,255	I258T	probably damaging	Het
Cma2	A	G	14: 55,973,678		probably benign	Het
Ddost	T	A	4: 138,309,653	S176T	probably benign	Het
Ddx19b	A	T	8: 111,023,964		probably null	Het
Dmxl2	A	G	9: 54,378,939	I2681T	probably damaging	Het
Ern1	C	T	11: 106,398,586	E964K	probably benign	Het
Galntl5	C	T	5: 25,220,174	R430C	probably benign	Het
Gga3	A	G	11: 115,587,433	L511P	probably damaging	Het
Gm7271	G	T	5: 76,500,487	V47L	possibly damaging	Het
Gria2	C	T	3: 80,710,858		probably benign	Het
Hmbs	A	T	9: 44,341,652	L28*	probably null	Het
Iffo2	A	G	4: 139,603,221	E220G	probably damaging	Het
Ifi30	A	G	8: 70,764,918		probably benign	Het
Irf2	T	A	8: 46,846,061	C297S	probably benign	Het
Izumo4	T	C	10: 80,703,084	Y94H	probably damaging	Het
Klhdc9	A	G	1: 171,359,785	V215A	probably benign	Het
Kmt2a	T	C	9: 44,819,964		probably benign	Het
Kmt2c	A	T	5: 25,375,957	C513S	probably damaging	Het
Lyg1	A	T	1: 37,949,896	M81K	possibly damaging	Het
Maip1	T	G	1: 57,415,693	W279G	probably damaging	Het
Myo7a	T	C	7: 98,071,937	T1263A	probably benign	Het
Naa15	T	A	3: 51,465,639	I701N	possibly damaging	Het
Ncoa3	A	G	2: 166,068,543	N1292S	probably benign	Het
Necab2	T	A	8: 119,454,240		probably benign	Het
Nfatc1	T	A	18: 80,698,042	I234F	possibly damaging	Het
Olfm1	G	A	2: 28,208,211	R95K	possibly damaging	Het
Olfr1118	A	G	2: 87,309,058	T90A	probably benign	Het
Olfr1329	A	T	4: 118,916,626	N280K	possibly damaging	Het
Otoa	T	C	7: 121,156,527		probably null	Het
Padi4	GCTGCGTACCTCCAC	GC	4: 140,748,449		probably benign	Het
Pard6g	A	G	18: 80,117,122	D150G	probably damaging	Het
Pax5	A	G	4: 44,609,783	L215S	probably damaging	Het
Pja2	A	T	17: 64,287,521		probably benign	Het
Plk4	T	A	3: 40,811,219		probably benign	Het
Polr1a	A	T	6: 71,978,421	H1687L	possibly damaging	Het
Ptcd2	G	A	13: 99,343,391	L41F	probably damaging	Het
Ropn1	T	A	16: 34,669,964	S62T	probably benign	Het
Setd1a	T	C	7: 127,796,051		probably benign	Het
Setdb1	T	C	3: 95,327,686	D902G	probably damaging	Het
Sik3	T	A	9: 46,208,770	L719Q	probably damaging	Het
Slc36a1	G	T	11: 55,232,507	V433F	probably benign	Het
Slc6a3	T	C	13: 73,557,050	V220A	possibly damaging	Het
Slc6a5	A	T	7: 49,911,791	R24W	probably damaging	Het
Smox	G	T	2: 131,520,644	R281L	probably benign	Het
Sulf2	G	T	2: 166,093,516	H226N	probably damaging	Het
Syne2	C	T	12: 76,059,584		probably null	Het
Tenm3	C	T	8: 48,287,791	S1210N	possibly damaging	Het
Trf	C	T	9: 103,217,501	V92M	probably damaging	Het
Ttn	A	G	2: 76,709,373	V34423A	possibly damaging	Het
Vmn2r118	A	G	17: 55,611,021		probably benign	Het
Vmn2r19	A	G	6: 123,309,744	Y112C	probably damaging	Het
Wdr66	C	T	5: 123,290,054	T538M	probably damaging	Het
Zfp326	G	T	5: 105,878,775	A15S	possibly damaging	Het

Other mutations in Tns1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Tns1	APN	1	73924969	missense	probably damaging	0.99
IGL01288:Tns1	APN	1	73953810	missense	probably damaging	1.00
IGL01536:Tns1	APN	1	73919648	splice site	probably benign
IGL01568:Tns1	APN	1	73953509	missense	probably damaging	1.00
IGL01683:Tns1	APN	1	73953269	missense	probably damaging	0.98
IGL02267:Tns1	APN	1	73992131	missense	possibly damaging	0.95
IGL02597:Tns1	APN	1	73985873	critical splice donor site	probably null
IGL02819:Tns1	APN	1	73937248	missense	probably damaging	0.99
IGL03370:Tns1	APN	1	73985894	missense	probably damaging	1.00
R0087:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R0207:Tns1	UTSW	1	73937318	critical splice acceptor site	probably null
R0543:Tns1	UTSW	1	73952697	missense	probably benign	0.01
R0552:Tns1	UTSW	1	73920563	missense	probably damaging	1.00
R0720:Tns1	UTSW	1	73925581	missense	probably benign	0.03
R0828:Tns1	UTSW	1	73919666	missense	probably damaging	1.00
R1034:Tns1	UTSW	1	73941969	missense	probably damaging	1.00
R1061:Tns1	UTSW	1	73917672	missense	probably damaging	1.00
R1819:Tns1	UTSW	1	73916476	splice site	probably benign
R1826:Tns1	UTSW	1	73953634	start codon destroyed	probably null	0.91
R2208:Tns1	UTSW	1	74079240	missense	probably damaging	1.00
R3723:Tns1	UTSW	1	73924940	missense	probably damaging	0.99
R4079:Tns1	UTSW	1	73995308	missense	probably damaging	1.00
R4111:Tns1	UTSW	1	73941932	missense	probably damaging	1.00
R4155:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4156:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4157:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4274:Tns1	UTSW	1	73928098	missense	probably damaging	1.00
R4426:Tns1	UTSW	1	73985749	missense	probably damaging	0.97
R4649:Tns1	UTSW	1	73953771	missense	probably damaging	1.00
R4742:Tns1	UTSW	1	74124290	critical splice donor site	probably null
R4869:Tns1	UTSW	1	73952615	missense	probably benign
R4961:Tns1	UTSW	1	73935915	missense	probably benign	0.35
R5025:Tns1	UTSW	1	73925482	missense	probably damaging	1.00
R5035:Tns1	UTSW	1	73953820	start gained	probably benign
R5062:Tns1	UTSW	1	73952864	missense	probably damaging	1.00
R5080:Tns1	UTSW	1	73952940	missense	probably damaging	1.00
R5213:Tns1	UTSW	1	73953612	missense	probably damaging	1.00
R5256:Tns1	UTSW	1	73995426	intron	probably benign
R5368:Tns1	UTSW	1	73941017	missense	probably benign	0.07
R5391:Tns1	UTSW	1	73990409	splice site	probably null
R5587:Tns1	UTSW	1	73920596	missense	possibly damaging	0.94
R5735:Tns1	UTSW	1	73927979	missense	probably benign	0.00
R5855:Tns1	UTSW	1	73918033	missense	possibly damaging	0.83
R5999:Tns1	UTSW	1	73928097	nonsense	probably null
R6122:Tns1	UTSW	1	73952419	critical splice donor site	probably null
R6148:Tns1	UTSW	1	73953453	missense	probably damaging	1.00
R6457:Tns1	UTSW	1	73918050	missense	probably damaging	0.99
R6525:Tns1	UTSW	1	73953470	missense	probably damaging	1.00
R6712:Tns1	UTSW	1	74079301	nonsense	probably null
R6773:Tns1	UTSW	1	73919707	missense	probably damaging	1.00
R6825:Tns1	UTSW	1	74002323	nonsense	probably null
R7085:Tns1	UTSW	1	73925462	missense	probably benign	0.00
R7128:Tns1	UTSW	1	73995304	missense
R7209:Tns1	UTSW	1	73953915	missense	possibly damaging	0.68
R7348:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R7570:Tns1	UTSW	1	73953479	missense	probably damaging	1.00
R7670:Tns1	UTSW	1	73952477	missense	possibly damaging	0.93
R7769:Tns1	UTSW	1	73953371	missense	probably damaging	0.99
R7833:Tns1	UTSW	1	74091331	intron	probably benign
R7916:Tns1	UTSW	1	74091331	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCACCTGCCGATGGCTCAAACTG -3'
(R):5'- AGAAAGCCCCGACTTCCTCTTGAC -3'

Sequencing Primer
(F):5'- GATGGCTCAAACTGGGACTACC -3'
(R):5'- CCTCTTGACTGAGTGGAGC -3'

Posted On

2013-05-09