Incidental Mutation 'R4788:Gbp2b'
ID367230
Institutional Source Beutler Lab
Gene Symbol Gbp2b
Ensembl Gene ENSMUSG00000040264
Gene Nameguanylate binding protein 2b
SynonymsGbp1, Mpa1, Mag-1, Gbp-1, Mpa-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location142594847-142619179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 142611410 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 509 (K509T)
Ref Sequence ENSEMBL: ENSMUSP00000029936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029936]
Predicted Effect probably benign
Transcript: ENSMUST00000029936
AA Change: K509T

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264
AA Change: K509T

DomainStartEndE-ValueType
Pfam:GBP 18 280 4.1e-122 PFAM
Pfam:GBP_C 282 578 5.5e-125 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Gbp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Gbp2b APN 3 142598312 missense probably damaging 1.00
IGL01892:Gbp2b APN 3 142603620 missense probably benign 0.03
IGL01989:Gbp2b APN 3 142611440 missense probably benign 0.19
IGL02019:Gbp2b APN 3 142606990 missense possibly damaging 0.52
IGL02338:Gbp2b APN 3 142604226 missense probably benign 0.09
IGL02657:Gbp2b APN 3 142604112 missense probably damaging 1.00
IGL03148:Gbp2b APN 3 142606881 missense probably benign 0.00
FR4304:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4340:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4342:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4589:Gbp2b UTSW 3 142603652 missense probably benign 0.00
R0329:Gbp2b UTSW 3 142608176 missense probably benign 0.01
R0345:Gbp2b UTSW 3 142608183 missense probably damaging 1.00
R0358:Gbp2b UTSW 3 142606789 missense probably damaging 1.00
R0732:Gbp2b UTSW 3 142606978 missense probably benign
R1163:Gbp2b UTSW 3 142599096 missense probably damaging 1.00
R1550:Gbp2b UTSW 3 142606830 missense probably damaging 0.99
R1629:Gbp2b UTSW 3 142610974 missense possibly damaging 0.93
R1886:Gbp2b UTSW 3 142608302 missense probably benign
R1887:Gbp2b UTSW 3 142608302 missense probably benign
R2188:Gbp2b UTSW 3 142608279 missense probably benign 0.44
R2261:Gbp2b UTSW 3 142606735 missense probably benign 0.00
R3977:Gbp2b UTSW 3 142603709 missense probably benign 0.02
R4718:Gbp2b UTSW 3 142598995 missense probably damaging 1.00
R4807:Gbp2b UTSW 3 142598245 missense probably benign 0.02
R5042:Gbp2b UTSW 3 142611463 missense probably benign 0.03
R5087:Gbp2b UTSW 3 142598254 missense probably damaging 1.00
R5114:Gbp2b UTSW 3 142598185 missense probably damaging 1.00
R5414:Gbp2b UTSW 3 142599091 missense probably damaging 1.00
R5567:Gbp2b UTSW 3 142611365 missense possibly damaging 0.75
R5625:Gbp2b UTSW 3 142599045 missense probably damaging 1.00
R5685:Gbp2b UTSW 3 142608158 missense probably benign
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6408:Gbp2b UTSW 3 142618138 missense probably benign 0.00
R6500:Gbp2b UTSW 3 142611491 missense probably benign 0.06
R6581:Gbp2b UTSW 3 142608238 nonsense probably null
R6582:Gbp2b UTSW 3 142611040 missense possibly damaging 0.53
R6847:Gbp2b UTSW 3 142598179 missense probably damaging 0.96
R6923:Gbp2b UTSW 3 142600559 missense probably benign 0.01
R7120:Gbp2b UTSW 3 142606746 missense probably benign 0.01
R7255:Gbp2b UTSW 3 142608117 missense probably damaging 1.00
R7454:Gbp2b UTSW 3 142598159 missense possibly damaging 0.75
R7643:Gbp2b UTSW 3 142603609 missense probably benign 0.07
R8039:Gbp2b UTSW 3 142618164 missense probably benign 0.02
R8312:Gbp2b UTSW 3 142599051 missense probably benign
R8312:Gbp2b UTSW 3 142599054 missense probably damaging 0.96
R8391:Gbp2b UTSW 3 142604133 missense probably damaging 1.00
R8418:Gbp2b UTSW 3 142603705 missense probably benign 0.01
R8721:Gbp2b UTSW 3 142606944 missense possibly damaging 0.93
R8842:Gbp2b UTSW 3 142606815 missense probably benign
R8849:Gbp2b UTSW 3 142608152 missense probably benign 0.00
R8874:Gbp2b UTSW 3 142608279 missense probably benign 0.03
Z1177:Gbp2b UTSW 3 142604316 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGACATGGCATTCATTGTGC -3'
(R):5'- ACTGCATGGTTGGGTCTCAG -3'

Sequencing Primer
(F):5'- CCAGTTTTCAGGGTAAAGATTCCAC -3'
(R):5'- AGAATATACCTTGTTTTGCTGGGAC -3'
Posted On2015-12-29