Incidental Mutation 'R4788:Pkhd1l1'
ID 367275
Institutional Source Beutler Lab
Gene Symbol Pkhd1l1
Ensembl Gene ENSMUSG00000038725
Gene Name polycystic kidney and hepatic disease 1-like 1
Synonyms PKHDL1, D86 mRNA, fibrocystin L
Accession Numbers

Genbank: NM_138674; MGI: 2183153

Essential gene? Non essential (E-score: 0.000) question?
Stock # R4788 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 44457494-44601369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 44498021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 489 (Q489L)
Ref Sequence ENSEMBL: ENSMUSP00000147447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000038336
AA Change: Q489L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: Q489L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 1.6e-16 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1322 1.1e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 5.1e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 2.1e-10 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166957
AA Change: Q489L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: Q489L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 9.4e-18 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1323 3e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 3.7e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 9.7e-12 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209244
AA Change: Q489L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 (GRCm38) I128K probably damaging Het
Abca4 G A 3: 122,166,712 (GRCm38) D815N probably damaging Het
Abcc9 A T 6: 142,620,730 (GRCm38) C1135* probably null Het
Ap3b1 G A 13: 94,565,641 (GRCm38) M1067I unknown Het
Arhgap15 T C 2: 43,748,890 (GRCm38) M1T probably null Het
Boc T C 16: 44,500,433 (GRCm38) D288G probably damaging Het
Brsk1 G T 7: 4,698,955 (GRCm38) probably null Het
Cabp1 T C 5: 115,175,471 (GRCm38) N226S probably benign Het
Capn13 A T 17: 73,337,432 (GRCm38) Y367* probably null Het
Ccdc191 A G 16: 43,956,822 (GRCm38) E632G probably damaging Het
Cit T C 5: 115,933,506 (GRCm38) S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 (GRCm38) V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 (GRCm38) N157S probably damaging Het
Col6a3 A G 1: 90,772,950 (GRCm38) probably null Het
Coq2 A T 5: 100,657,909 (GRCm38) V287E probably damaging Het
Cpa6 T C 1: 10,408,277 (GRCm38) K278R possibly damaging Het
Cybb C G X: 9,450,750 (GRCm38) D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 (GRCm38) Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 (GRCm38) W160L probably damaging Het
Dennd4c A G 4: 86,819,963 (GRCm38) T994A probably benign Het
Dhx57 T C 17: 80,275,331 (GRCm38) T229A probably benign Het
Dnah6 T A 6: 73,129,530 (GRCm38) R1741S probably damaging Het
Dock1 T A 7: 135,145,484 (GRCm38) V1508D probably damaging Het
Donson T C 16: 91,687,833 (GRCm38) T117A possibly damaging Het
Dtnb A G 12: 3,772,699 (GRCm38) D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 (GRCm38) N470S probably damaging Het
Focad T A 4: 88,357,469 (GRCm38) V1105E unknown Het
Fry T C 5: 150,399,636 (GRCm38) V1084A probably benign Het
Gabra1 G T 11: 42,147,153 (GRCm38) R213S probably damaging Het
Gbp2b A C 3: 142,611,410 (GRCm38) K509T probably benign Het
Gprc6a T C 10: 51,615,008 (GRCm38) T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 (GRCm38) D101G probably damaging Het
Ifna11 G A 4: 88,820,008 (GRCm38) W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 (GRCm38) M100L probably benign Het
Lgmn T A 12: 102,402,677 (GRCm38) Y181F probably benign Het
Map4k4 T C 1: 40,003,916 (GRCm38) S644P probably benign Het
Med9 T A 11: 59,948,440 (GRCm38) N58K probably benign Het
Nav1 C T 1: 135,469,723 (GRCm38) A903T probably benign Het
Nop53 T C 7: 15,942,315 (GRCm38) E153G possibly damaging Het
Nop56 G T 2: 130,278,900 (GRCm38) V190L probably benign Het
Nyap2 A T 1: 81,269,397 (GRCm38) M687L probably benign Het
Olfr1254 G A 2: 89,789,136 (GRCm38) S72F probably damaging Het
Olfr146 T C 9: 39,018,921 (GRCm38) T207A probably benign Het
Olfr943 A G 9: 39,184,612 (GRCm38) T145A probably benign Het
Osbp2 T C 11: 3,863,320 (GRCm38) K183R probably benign Het
Pappa2 A G 1: 158,783,917 (GRCm38) V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 (GRCm38) Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 (GRCm38) V317F probably damaging Het
Poln A T 5: 34,129,331 (GRCm38) S164R probably benign Het
Ptf1a T C 2: 19,445,951 (GRCm38) S31P probably benign Het
Rasal3 A T 17: 32,399,338 (GRCm38) D164E probably benign Het
Rnf170 A G 8: 26,140,863 (GRCm38) E168G probably damaging Het
Rubcn A G 16: 32,836,408 (GRCm38) probably null Het
Sec16b A T 1: 157,561,524 (GRCm38) T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 (GRCm38) V882A probably benign Het
Sfpq A G 4: 127,025,998 (GRCm38) E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 (GRCm38) L187P probably damaging Het
Skint6 C T 4: 113,238,336 (GRCm38) G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 (GRCm38) I526V probably benign Het
Spata48 T C 11: 11,488,652 (GRCm38) probably null Het
Ssh2 A T 11: 77,429,798 (GRCm38) N328Y probably damaging Het
Taok2 G A 7: 126,868,132 (GRCm38) S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 (GRCm38) K57R probably benign Het
Tom1l2 A G 11: 60,249,018 (GRCm38) L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 (GRCm38) R356* probably null Het
Zan A G 5: 137,442,113 (GRCm38) L1953P unknown Het
Zfhx3 T C 8: 108,794,210 (GRCm38) S655P probably damaging Het
Zmym1 T C 4: 127,054,297 (GRCm38) T94A probably benign Het
Other mutations in Pkhd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pkhd1l1 APN 15 44,477,586 (GRCm38) missense probably damaging 1.00
IGL00235:Pkhd1l1 APN 15 44,556,019 (GRCm38) missense probably damaging 1.00
IGL00264:Pkhd1l1 APN 15 44,491,029 (GRCm38) missense possibly damaging 0.67
IGL00537:Pkhd1l1 APN 15 44,591,992 (GRCm38) missense possibly damaging 0.88
IGL00537:Pkhd1l1 APN 15 44,500,047 (GRCm38) missense probably benign 0.42
IGL00580:Pkhd1l1 APN 15 44,586,474 (GRCm38) missense probably damaging 0.98
IGL01085:Pkhd1l1 APN 15 44,562,752 (GRCm38) splice site probably null
IGL01089:Pkhd1l1 APN 15 44,483,869 (GRCm38) splice site probably benign
IGL01094:Pkhd1l1 APN 15 44,546,929 (GRCm38) missense probably benign 0.09
IGL01120:Pkhd1l1 APN 15 44,505,312 (GRCm38) critical splice donor site probably null
IGL01307:Pkhd1l1 APN 15 44,530,029 (GRCm38) missense possibly damaging 0.82
IGL01362:Pkhd1l1 APN 15 44,532,982 (GRCm38) missense probably benign 0.00
IGL01403:Pkhd1l1 APN 15 44,483,833 (GRCm38) nonsense probably null
IGL01546:Pkhd1l1 APN 15 44,566,316 (GRCm38) missense probably damaging 1.00
IGL01596:Pkhd1l1 APN 15 44,529,410 (GRCm38) missense possibly damaging 0.50
IGL01696:Pkhd1l1 APN 15 44,529,351 (GRCm38) missense possibly damaging 0.79
IGL01844:Pkhd1l1 APN 15 44,499,400 (GRCm38) splice site probably benign
IGL02007:Pkhd1l1 APN 15 44,533,733 (GRCm38) splice site probably benign
IGL02041:Pkhd1l1 APN 15 44,493,056 (GRCm38) splice site probably null
IGL02171:Pkhd1l1 APN 15 44,516,146 (GRCm38) missense possibly damaging 0.80
IGL02206:Pkhd1l1 APN 15 44,512,849 (GRCm38) missense probably benign 0.08
IGL02266:Pkhd1l1 APN 15 44,573,614 (GRCm38) missense probably damaging 1.00
IGL02487:Pkhd1l1 APN 15 44,459,426 (GRCm38) missense possibly damaging 0.65
IGL02488:Pkhd1l1 APN 15 44,558,597 (GRCm38) missense probably benign
IGL02522:Pkhd1l1 APN 15 44,555,902 (GRCm38) missense possibly damaging 0.71
IGL02554:Pkhd1l1 APN 15 44,578,500 (GRCm38) missense probably damaging 1.00
IGL02566:Pkhd1l1 APN 15 44,526,054 (GRCm38) splice site probably null
IGL02602:Pkhd1l1 APN 15 44,557,931 (GRCm38) missense probably damaging 1.00
IGL02606:Pkhd1l1 APN 15 44,589,456 (GRCm38) missense probably benign 0.00
IGL02623:Pkhd1l1 APN 15 44,584,873 (GRCm38) missense probably damaging 1.00
IGL02634:Pkhd1l1 APN 15 44,539,667 (GRCm38) missense probably damaging 1.00
IGL02637:Pkhd1l1 APN 15 44,564,324 (GRCm38) missense probably damaging 1.00
IGL02651:Pkhd1l1 APN 15 44,483,814 (GRCm38) missense probably damaging 1.00
IGL02679:Pkhd1l1 APN 15 44,530,045 (GRCm38) critical splice donor site probably null
IGL02684:Pkhd1l1 APN 15 44,516,209 (GRCm38) critical splice donor site probably null
IGL02739:Pkhd1l1 APN 15 44,540,950 (GRCm38) missense probably benign 0.11
IGL02831:Pkhd1l1 APN 15 44,501,493 (GRCm38) missense probably benign 0.18
IGL02839:Pkhd1l1 APN 15 44,529,543 (GRCm38) missense probably damaging 0.98
IGL02944:Pkhd1l1 APN 15 44,501,531 (GRCm38) missense probably damaging 1.00
IGL02957:Pkhd1l1 APN 15 44,512,908 (GRCm38) missense probably damaging 1.00
IGL03001:Pkhd1l1 APN 15 44,558,004 (GRCm38) missense probably damaging 1.00
IGL03030:Pkhd1l1 APN 15 44,596,902 (GRCm38) missense probably benign 0.41
IGL03030:Pkhd1l1 APN 15 44,591,976 (GRCm38) missense probably benign 0.00
IGL03132:Pkhd1l1 APN 15 44,574,617 (GRCm38) missense probably damaging 1.00
IGL03194:Pkhd1l1 APN 15 44,518,135 (GRCm38) missense probably damaging 1.00
IGL03219:Pkhd1l1 APN 15 44,596,895 (GRCm38) missense possibly damaging 0.62
IGL03236:Pkhd1l1 APN 15 44,581,826 (GRCm38) missense probably damaging 1.00
IGL03266:Pkhd1l1 APN 15 44,538,952 (GRCm38) missense probably damaging 1.00
IGL03276:Pkhd1l1 APN 15 44,594,584 (GRCm38) missense possibly damaging 0.77
IGL03284:Pkhd1l1 APN 15 44,547,518 (GRCm38) splice site probably benign
IGL03377:Pkhd1l1 APN 15 44,484,351 (GRCm38) splice site probably null
R0310_Pkhd1l1_251 UTSW 15 44,522,738 (GRCm38) splice site probably benign
R0344_Pkhd1l1_462 UTSW 15 44,597,011 (GRCm38) missense probably benign 0.15
R1737_Pkhd1l1_815 UTSW 15 44,547,509 (GRCm38) critical splice donor site probably null
R5049_Pkhd1l1_556 UTSW 15 44,457,616 (GRCm38) missense probably benign 0.00
K7371:Pkhd1l1 UTSW 15 44,500,067 (GRCm38) missense possibly damaging 0.94
K7371:Pkhd1l1 UTSW 15 44,537,442 (GRCm38) missense possibly damaging 0.67
N/A - 287:Pkhd1l1 UTSW 15 44,582,258 (GRCm38) missense probably damaging 0.98
P4717OSA:Pkhd1l1 UTSW 15 44,528,247 (GRCm38) missense probably damaging 1.00
P4717OSA:Pkhd1l1 UTSW 15 44,523,499 (GRCm38) missense probably benign 0.17
R0007:Pkhd1l1 UTSW 15 44,574,398 (GRCm38) splice site probably benign
R0020:Pkhd1l1 UTSW 15 44,556,872 (GRCm38) missense probably damaging 1.00
R0034:Pkhd1l1 UTSW 15 44,504,009 (GRCm38) missense probably benign 0.00
R0040:Pkhd1l1 UTSW 15 44,573,625 (GRCm38) missense probably damaging 1.00
R0050:Pkhd1l1 UTSW 15 44,573,807 (GRCm38) missense possibly damaging 0.79
R0050:Pkhd1l1 UTSW 15 44,573,807 (GRCm38) missense possibly damaging 0.79
R0063:Pkhd1l1 UTSW 15 44,529,237 (GRCm38) missense probably damaging 1.00
R0063:Pkhd1l1 UTSW 15 44,529,237 (GRCm38) missense probably damaging 1.00
R0086:Pkhd1l1 UTSW 15 44,556,008 (GRCm38) missense possibly damaging 0.94
R0103:Pkhd1l1 UTSW 15 44,597,141 (GRCm38) missense probably benign
R0103:Pkhd1l1 UTSW 15 44,597,141 (GRCm38) missense probably benign
R0127:Pkhd1l1 UTSW 15 44,554,605 (GRCm38) missense probably damaging 0.99
R0226:Pkhd1l1 UTSW 15 44,526,784 (GRCm38) missense possibly damaging 0.65
R0268:Pkhd1l1 UTSW 15 44,597,011 (GRCm38) missense probably benign 0.15
R0294:Pkhd1l1 UTSW 15 44,560,435 (GRCm38) missense probably benign 0.05
R0310:Pkhd1l1 UTSW 15 44,522,738 (GRCm38) splice site probably benign
R0344:Pkhd1l1 UTSW 15 44,597,011 (GRCm38) missense probably benign 0.15
R0449:Pkhd1l1 UTSW 15 44,501,519 (GRCm38) missense probably damaging 1.00
R0492:Pkhd1l1 UTSW 15 44,519,690 (GRCm38) missense probably benign 0.03
R0505:Pkhd1l1 UTSW 15 44,589,418 (GRCm38) missense probably damaging 1.00
R0529:Pkhd1l1 UTSW 15 44,526,754 (GRCm38) missense possibly damaging 0.62
R0543:Pkhd1l1 UTSW 15 44,523,491 (GRCm38) critical splice acceptor site probably null
R0552:Pkhd1l1 UTSW 15 44,489,546 (GRCm38) missense probably damaging 0.98
R0558:Pkhd1l1 UTSW 15 44,484,424 (GRCm38) missense probably damaging 0.97
R0609:Pkhd1l1 UTSW 15 44,467,424 (GRCm38) missense possibly damaging 0.48
R0619:Pkhd1l1 UTSW 15 44,483,838 (GRCm38) missense probably damaging 1.00
R0727:Pkhd1l1 UTSW 15 44,535,788 (GRCm38) missense possibly damaging 0.80
R0787:Pkhd1l1 UTSW 15 44,529,264 (GRCm38) missense probably damaging 1.00
R0846:Pkhd1l1 UTSW 15 44,495,597 (GRCm38) missense probably damaging 1.00
R0909:Pkhd1l1 UTSW 15 44,538,883 (GRCm38) splice site probably null
R0942:Pkhd1l1 UTSW 15 44,532,959 (GRCm38) missense probably benign 0.01
R1056:Pkhd1l1 UTSW 15 44,591,964 (GRCm38) missense probably damaging 1.00
R1147:Pkhd1l1 UTSW 15 44,537,441 (GRCm38) missense probably null 0.15
R1147:Pkhd1l1 UTSW 15 44,537,441 (GRCm38) missense probably null 0.15
R1187:Pkhd1l1 UTSW 15 44,498,051 (GRCm38) missense possibly damaging 0.65
R1328:Pkhd1l1 UTSW 15 44,497,996 (GRCm38) missense probably benign 0.01
R1331:Pkhd1l1 UTSW 15 44,589,597 (GRCm38) missense probably damaging 1.00
R1331:Pkhd1l1 UTSW 15 44,505,547 (GRCm38) missense probably damaging 1.00
R1332:Pkhd1l1 UTSW 15 44,505,547 (GRCm38) missense probably damaging 1.00
R1335:Pkhd1l1 UTSW 15 44,505,547 (GRCm38) missense probably damaging 1.00
R1338:Pkhd1l1 UTSW 15 44,526,724 (GRCm38) missense probably damaging 1.00
R1440:Pkhd1l1 UTSW 15 44,540,988 (GRCm38) splice site probably benign
R1445:Pkhd1l1 UTSW 15 44,505,644 (GRCm38) missense probably benign 0.32
R1458:Pkhd1l1 UTSW 15 44,516,115 (GRCm38) missense probably benign 0.01
R1469:Pkhd1l1 UTSW 15 44,536,886 (GRCm38) missense probably benign 0.45
R1469:Pkhd1l1 UTSW 15 44,536,886 (GRCm38) missense probably benign 0.45
R1500:Pkhd1l1 UTSW 15 44,545,494 (GRCm38) missense probably damaging 1.00
R1528:Pkhd1l1 UTSW 15 44,526,724 (GRCm38) missense probably damaging 1.00
R1542:Pkhd1l1 UTSW 15 44,528,191 (GRCm38) missense probably benign 0.44
R1568:Pkhd1l1 UTSW 15 44,545,501 (GRCm38) splice site probably null
R1571:Pkhd1l1 UTSW 15 44,526,841 (GRCm38) missense probably benign
R1572:Pkhd1l1 UTSW 15 44,543,473 (GRCm38) missense probably benign 0.01
R1604:Pkhd1l1 UTSW 15 44,467,367 (GRCm38) nonsense probably null
R1638:Pkhd1l1 UTSW 15 44,597,117 (GRCm38) missense probably benign 0.06
R1639:Pkhd1l1 UTSW 15 44,540,955 (GRCm38) missense probably damaging 0.99
R1737:Pkhd1l1 UTSW 15 44,547,509 (GRCm38) critical splice donor site probably null
R1816:Pkhd1l1 UTSW 15 44,528,239 (GRCm38) missense possibly damaging 0.91
R1826:Pkhd1l1 UTSW 15 44,503,345 (GRCm38) missense possibly damaging 0.75
R1880:Pkhd1l1 UTSW 15 44,525,242 (GRCm38) missense probably benign 0.13
R1930:Pkhd1l1 UTSW 15 44,503,337 (GRCm38) missense possibly damaging 0.69
R1933:Pkhd1l1 UTSW 15 44,540,884 (GRCm38) missense possibly damaging 0.48
R1938:Pkhd1l1 UTSW 15 44,500,038 (GRCm38) missense probably benign
R1975:Pkhd1l1 UTSW 15 44,529,713 (GRCm38) missense probably damaging 1.00
R1999:Pkhd1l1 UTSW 15 44,499,982 (GRCm38) splice site probably null
R2037:Pkhd1l1 UTSW 15 44,568,221 (GRCm38) splice site probably null
R2045:Pkhd1l1 UTSW 15 44,479,654 (GRCm38) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,581,741 (GRCm38) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,547,513 (GRCm38) splice site probably benign
R2063:Pkhd1l1 UTSW 15 44,550,752 (GRCm38) missense possibly damaging 0.69
R2072:Pkhd1l1 UTSW 15 44,558,639 (GRCm38) missense probably damaging 1.00
R2073:Pkhd1l1 UTSW 15 44,558,639 (GRCm38) missense probably damaging 1.00
R2075:Pkhd1l1 UTSW 15 44,558,639 (GRCm38) missense probably damaging 1.00
R2078:Pkhd1l1 UTSW 15 44,527,767 (GRCm38) missense probably benign 0.08
R2116:Pkhd1l1 UTSW 15 44,569,482 (GRCm38) missense probably damaging 0.97
R2133:Pkhd1l1 UTSW 15 44,516,185 (GRCm38) missense possibly damaging 0.91
R2138:Pkhd1l1 UTSW 15 44,501,457 (GRCm38) missense probably damaging 1.00
R2139:Pkhd1l1 UTSW 15 44,529,818 (GRCm38) missense possibly damaging 0.46
R2145:Pkhd1l1 UTSW 15 44,512,877 (GRCm38) splice site probably null
R2150:Pkhd1l1 UTSW 15 44,499,982 (GRCm38) splice site probably null
R2177:Pkhd1l1 UTSW 15 44,459,395 (GRCm38) missense probably benign
R2184:Pkhd1l1 UTSW 15 44,499,296 (GRCm38) missense possibly damaging 0.89
R2216:Pkhd1l1 UTSW 15 44,573,895 (GRCm38) missense probably damaging 1.00
R2226:Pkhd1l1 UTSW 15 44,512,792 (GRCm38) missense possibly damaging 0.79
R2227:Pkhd1l1 UTSW 15 44,512,792 (GRCm38) missense possibly damaging 0.79
R2243:Pkhd1l1 UTSW 15 44,546,927 (GRCm38) missense probably damaging 1.00
R2290:Pkhd1l1 UTSW 15 44,528,250 (GRCm38) missense probably benign 0.03
R2294:Pkhd1l1 UTSW 15 44,479,607 (GRCm38) missense probably damaging 0.99
R2346:Pkhd1l1 UTSW 15 44,560,506 (GRCm38) missense possibly damaging 0.82
R2356:Pkhd1l1 UTSW 15 44,533,019 (GRCm38) missense probably benign 0.00
R2386:Pkhd1l1 UTSW 15 44,528,178 (GRCm38) missense probably benign 0.00
R2404:Pkhd1l1 UTSW 15 44,550,820 (GRCm38) missense probably damaging 1.00
R2504:Pkhd1l1 UTSW 15 44,485,428 (GRCm38) missense probably damaging 0.97
R2679:Pkhd1l1 UTSW 15 44,545,386 (GRCm38) missense probably damaging 0.99
R2860:Pkhd1l1 UTSW 15 44,540,871 (GRCm38) missense probably damaging 1.00
R2861:Pkhd1l1 UTSW 15 44,540,871 (GRCm38) missense probably damaging 1.00
R2862:Pkhd1l1 UTSW 15 44,540,871 (GRCm38) missense probably damaging 1.00
R2972:Pkhd1l1 UTSW 15 44,547,248 (GRCm38) missense possibly damaging 0.65
R3016:Pkhd1l1 UTSW 15 44,545,370 (GRCm38) missense probably benign 0.02
R3162:Pkhd1l1 UTSW 15 44,505,528 (GRCm38) missense probably damaging 1.00
R3162:Pkhd1l1 UTSW 15 44,505,528 (GRCm38) missense probably damaging 1.00
R3416:Pkhd1l1 UTSW 15 44,547,364 (GRCm38) missense probably damaging 1.00
R3623:Pkhd1l1 UTSW 15 44,526,869 (GRCm38) missense probably damaging 1.00
R3687:Pkhd1l1 UTSW 15 44,546,587 (GRCm38) missense probably benign 0.17
R3755:Pkhd1l1 UTSW 15 44,589,406 (GRCm38) missense probably damaging 1.00
R3776:Pkhd1l1 UTSW 15 44,514,975 (GRCm38) critical splice donor site probably null
R3803:Pkhd1l1 UTSW 15 44,493,135 (GRCm38) missense probably benign 0.25
R3942:Pkhd1l1 UTSW 15 44,592,026 (GRCm38) critical splice donor site probably null
R4010:Pkhd1l1 UTSW 15 44,529,100 (GRCm38) missense possibly damaging 0.80
R4049:Pkhd1l1 UTSW 15 44,498,557 (GRCm38) missense probably damaging 1.00
R4059:Pkhd1l1 UTSW 15 44,550,760 (GRCm38) missense probably benign 0.01
R4179:Pkhd1l1 UTSW 15 44,523,649 (GRCm38) missense probably benign 0.45
R4184:Pkhd1l1 UTSW 15 44,591,906 (GRCm38) missense probably benign 0.00
R4369:Pkhd1l1 UTSW 15 44,505,553 (GRCm38) missense probably benign 0.00
R4462:Pkhd1l1 UTSW 15 44,581,804 (GRCm38) missense probably damaging 1.00
R4551:Pkhd1l1 UTSW 15 44,550,885 (GRCm38) missense probably damaging 1.00
R4618:Pkhd1l1 UTSW 15 44,539,682 (GRCm38) missense probably damaging 1.00
R4632:Pkhd1l1 UTSW 15 44,484,400 (GRCm38) missense probably benign 0.07
R4657:Pkhd1l1 UTSW 15 44,547,347 (GRCm38) missense probably damaging 1.00
R4716:Pkhd1l1 UTSW 15 44,556,032 (GRCm38) missense probably damaging 1.00
R4828:Pkhd1l1 UTSW 15 44,529,405 (GRCm38) missense possibly damaging 0.55
R4858:Pkhd1l1 UTSW 15 44,491,101 (GRCm38) missense probably damaging 0.99
R4860:Pkhd1l1 UTSW 15 44,537,378 (GRCm38) missense possibly damaging 0.77
R4860:Pkhd1l1 UTSW 15 44,537,378 (GRCm38) missense possibly damaging 0.77
R4951:Pkhd1l1 UTSW 15 44,533,891 (GRCm38) missense possibly damaging 0.82
R4963:Pkhd1l1 UTSW 15 44,504,025 (GRCm38) missense probably benign 0.00
R5023:Pkhd1l1 UTSW 15 44,528,191 (GRCm38) missense probably benign 0.44
R5023:Pkhd1l1 UTSW 15 44,582,227 (GRCm38) missense probably benign 0.00
R5035:Pkhd1l1 UTSW 15 44,568,324 (GRCm38) missense probably damaging 1.00
R5049:Pkhd1l1 UTSW 15 44,457,616 (GRCm38) missense probably benign 0.00
R5065:Pkhd1l1 UTSW 15 44,582,293 (GRCm38) missense possibly damaging 0.68
R5089:Pkhd1l1 UTSW 15 44,591,887 (GRCm38) missense probably benign 0.01
R5151:Pkhd1l1 UTSW 15 44,505,309 (GRCm38) missense probably benign 0.00
R5153:Pkhd1l1 UTSW 15 44,505,309 (GRCm38) missense probably benign 0.00
R5189:Pkhd1l1 UTSW 15 44,547,148 (GRCm38) missense probably damaging 1.00
R5204:Pkhd1l1 UTSW 15 44,547,041 (GRCm38) missense possibly damaging 0.51
R5216:Pkhd1l1 UTSW 15 44,495,647 (GRCm38) nonsense probably null
R5286:Pkhd1l1 UTSW 15 44,514,972 (GRCm38) nonsense probably null
R5292:Pkhd1l1 UTSW 15 44,529,566 (GRCm38) missense probably damaging 1.00
R5293:Pkhd1l1 UTSW 15 44,535,750 (GRCm38) missense probably benign 0.01
R5298:Pkhd1l1 UTSW 15 44,504,046 (GRCm38) missense probably benign 0.00
R5327:Pkhd1l1 UTSW 15 44,546,862 (GRCm38) missense probably damaging 1.00
R5346:Pkhd1l1 UTSW 15 44,540,967 (GRCm38) missense probably damaging 1.00
R5481:Pkhd1l1 UTSW 15 44,558,646 (GRCm38) missense probably damaging 1.00
R5645:Pkhd1l1 UTSW 15 44,532,992 (GRCm38) missense probably benign 0.18
R5718:Pkhd1l1 UTSW 15 44,545,417 (GRCm38) missense probably damaging 1.00
R5809:Pkhd1l1 UTSW 15 44,519,707 (GRCm38) missense probably benign 0.03
R5816:Pkhd1l1 UTSW 15 44,566,322 (GRCm38) missense probably benign 0.01
R5854:Pkhd1l1 UTSW 15 44,581,790 (GRCm38) missense probably damaging 1.00
R5876:Pkhd1l1 UTSW 15 44,578,588 (GRCm38) missense possibly damaging 0.51
R5909:Pkhd1l1 UTSW 15 44,526,763 (GRCm38) missense probably damaging 1.00
R5950:Pkhd1l1 UTSW 15 44,532,965 (GRCm38) missense probably benign 0.00
R5961:Pkhd1l1 UTSW 15 44,459,463 (GRCm38) missense probably damaging 1.00
R5972:Pkhd1l1 UTSW 15 44,545,416 (GRCm38) missense probably damaging 1.00
R5975:Pkhd1l1 UTSW 15 44,525,988 (GRCm38) missense probably damaging 1.00
R5982:Pkhd1l1 UTSW 15 44,489,504 (GRCm38) splice site probably null
R6066:Pkhd1l1 UTSW 15 44,528,129 (GRCm38) missense probably damaging 0.99
R6122:Pkhd1l1 UTSW 15 44,557,940 (GRCm38) missense probably damaging 1.00
R6248:Pkhd1l1 UTSW 15 44,529,559 (GRCm38) missense probably benign
R6294:Pkhd1l1 UTSW 15 44,570,028 (GRCm38) missense probably damaging 1.00
R6301:Pkhd1l1 UTSW 15 44,589,525 (GRCm38) missense probably damaging 0.99
R6526:Pkhd1l1 UTSW 15 44,498,089 (GRCm38) critical splice donor site probably null
R6707:Pkhd1l1 UTSW 15 44,529,143 (GRCm38) missense probably benign
R6736:Pkhd1l1 UTSW 15 44,557,940 (GRCm38) missense probably damaging 1.00
R6753:Pkhd1l1 UTSW 15 44,589,663 (GRCm38) missense probably benign 0.45
R6815:Pkhd1l1 UTSW 15 44,562,655 (GRCm38) missense probably damaging 1.00
R6874:Pkhd1l1 UTSW 15 44,589,527 (GRCm38) missense probably benign 0.06
R6942:Pkhd1l1 UTSW 15 44,522,629 (GRCm38) missense probably damaging 1.00
R6970:Pkhd1l1 UTSW 15 44,511,674 (GRCm38) missense possibly damaging 0.61
R6982:Pkhd1l1 UTSW 15 44,566,268 (GRCm38) missense probably damaging 0.97
R7103:Pkhd1l1 UTSW 15 44,573,631 (GRCm38) missense probably benign 0.02
R7116:Pkhd1l1 UTSW 15 44,557,976 (GRCm38) missense probably benign 0.00
R7135:Pkhd1l1 UTSW 15 44,584,978 (GRCm38) critical splice donor site probably null
R7143:Pkhd1l1 UTSW 15 44,573,637 (GRCm38) missense possibly damaging 0.93
R7177:Pkhd1l1 UTSW 15 44,467,404 (GRCm38) missense probably damaging 1.00
R7194:Pkhd1l1 UTSW 15 44,529,116 (GRCm38) missense probably damaging 1.00
R7204:Pkhd1l1 UTSW 15 44,523,553 (GRCm38) missense possibly damaging 0.90
R7215:Pkhd1l1 UTSW 15 44,528,163 (GRCm38) missense possibly damaging 0.78
R7218:Pkhd1l1 UTSW 15 44,522,695 (GRCm38) missense possibly damaging 0.49
R7225:Pkhd1l1 UTSW 15 44,546,941 (GRCm38) missense probably damaging 1.00
R7283:Pkhd1l1 UTSW 15 44,503,280 (GRCm38) missense probably benign 0.10
R7292:Pkhd1l1 UTSW 15 44,498,590 (GRCm38) missense probably benign
R7304:Pkhd1l1 UTSW 15 44,498,482 (GRCm38) missense possibly damaging 0.94
R7349:Pkhd1l1 UTSW 15 44,514,954 (GRCm38) missense probably damaging 1.00
R7359:Pkhd1l1 UTSW 15 44,589,486 (GRCm38) missense probably damaging 1.00
R7407:Pkhd1l1 UTSW 15 44,595,011 (GRCm38) missense possibly damaging 0.75
R7475:Pkhd1l1 UTSW 15 44,505,185 (GRCm38) nonsense probably null
R7481:Pkhd1l1 UTSW 15 44,512,911 (GRCm38) missense probably benign
R7554:Pkhd1l1 UTSW 15 44,495,470 (GRCm38) missense probably damaging 1.00
R7555:Pkhd1l1 UTSW 15 44,550,761 (GRCm38) missense possibly damaging 0.51
R7562:Pkhd1l1 UTSW 15 44,514,930 (GRCm38) missense possibly damaging 0.68
R7583:Pkhd1l1 UTSW 15 44,568,364 (GRCm38) critical splice donor site probably null
R7595:Pkhd1l1 UTSW 15 44,495,521 (GRCm38) missense probably damaging 1.00
R7749:Pkhd1l1 UTSW 15 44,527,737 (GRCm38) missense probably benign 0.00
R7754:Pkhd1l1 UTSW 15 44,586,408 (GRCm38) missense possibly damaging 0.94
R7761:Pkhd1l1 UTSW 15 44,529,884 (GRCm38) missense probably benign 0.00
R7774:Pkhd1l1 UTSW 15 44,540,907 (GRCm38) missense probably benign 0.03
R7785:Pkhd1l1 UTSW 15 44,543,569 (GRCm38) missense probably damaging 1.00
R7790:Pkhd1l1 UTSW 15 44,578,581 (GRCm38) missense probably damaging 1.00
R7804:Pkhd1l1 UTSW 15 44,597,138 (GRCm38) nonsense probably null
R7864:Pkhd1l1 UTSW 15 44,526,053 (GRCm38) critical splice donor site probably null
R7883:Pkhd1l1 UTSW 15 44,529,126 (GRCm38) missense probably damaging 1.00
R8031:Pkhd1l1 UTSW 15 44,512,834 (GRCm38) missense probably damaging 1.00
R8128:Pkhd1l1 UTSW 15 44,498,053 (GRCm38) missense possibly damaging 0.94
R8142:Pkhd1l1 UTSW 15 44,514,931 (GRCm38) missense probably benign 0.00
R8150:Pkhd1l1 UTSW 15 44,546,659 (GRCm38) missense possibly damaging 0.68
R8209:Pkhd1l1 UTSW 15 44,574,407 (GRCm38) missense possibly damaging 0.46
R8212:Pkhd1l1 UTSW 15 44,499,300 (GRCm38) missense probably benign 0.12
R8226:Pkhd1l1 UTSW 15 44,574,407 (GRCm38) missense possibly damaging 0.46
R8248:Pkhd1l1 UTSW 15 44,543,546 (GRCm38) missense probably damaging 0.99
R8299:Pkhd1l1 UTSW 15 44,581,934 (GRCm38) missense probably benign 0.26
R8425:Pkhd1l1 UTSW 15 44,574,515 (GRCm38) missense probably benign 0.01
R8485:Pkhd1l1 UTSW 15 44,560,400 (GRCm38) missense probably damaging 0.98
R8486:Pkhd1l1 UTSW 15 44,547,416 (GRCm38) missense probably damaging 1.00
R8701:Pkhd1l1 UTSW 15 44,574,683 (GRCm38) missense probably damaging 1.00
R8709:Pkhd1l1 UTSW 15 44,518,174 (GRCm38) missense probably benign 0.01
R8777:Pkhd1l1 UTSW 15 44,498,571 (GRCm38) missense probably damaging 1.00
R8777-TAIL:Pkhd1l1 UTSW 15 44,498,571 (GRCm38) missense probably damaging 1.00
R8845:Pkhd1l1 UTSW 15 44,505,254 (GRCm38) missense probably benign 0.30
R8846:Pkhd1l1 UTSW 15 44,546,962 (GRCm38) nonsense probably null
R8863:Pkhd1l1 UTSW 15 44,569,986 (GRCm38) nonsense probably null
R8917:Pkhd1l1 UTSW 15 44,533,007 (GRCm38) missense probably benign 0.04
R8936:Pkhd1l1 UTSW 15 44,538,916 (GRCm38) missense possibly damaging 0.94
R8962:Pkhd1l1 UTSW 15 44,536,895 (GRCm38) missense probably damaging 1.00
R8971:Pkhd1l1 UTSW 15 44,529,519 (GRCm38) missense possibly damaging 0.68
R8973:Pkhd1l1 UTSW 15 44,586,437 (GRCm38) missense probably damaging 1.00
R8982:Pkhd1l1 UTSW 15 44,523,673 (GRCm38) nonsense probably null
R8994:Pkhd1l1 UTSW 15 44,547,103 (GRCm38) missense probably damaging 0.99
R9004:Pkhd1l1 UTSW 15 44,543,372 (GRCm38) missense probably benign 0.16
R9064:Pkhd1l1 UTSW 15 44,562,642 (GRCm38) missense possibly damaging 0.93
R9173:Pkhd1l1 UTSW 15 44,520,756 (GRCm38) missense probably benign 0.09
R9185:Pkhd1l1 UTSW 15 44,589,623 (GRCm38) missense probably benign 0.01
R9213:Pkhd1l1 UTSW 15 44,495,478 (GRCm38) missense probably damaging 1.00
R9218:Pkhd1l1 UTSW 15 44,520,726 (GRCm38) missense possibly damaging 0.90
R9256:Pkhd1l1 UTSW 15 44,533,894 (GRCm38) critical splice donor site probably null
R9291:Pkhd1l1 UTSW 15 44,569,976 (GRCm38) missense probably damaging 1.00
R9309:Pkhd1l1 UTSW 15 44,536,893 (GRCm38) missense probably benign 0.00
R9319:Pkhd1l1 UTSW 15 44,529,578 (GRCm38) missense possibly damaging 0.46
R9339:Pkhd1l1 UTSW 15 44,589,553 (GRCm38) missense probably damaging 1.00
R9366:Pkhd1l1 UTSW 15 44,546,912 (GRCm38) missense probably benign 0.03
R9444:Pkhd1l1 UTSW 15 44,554,657 (GRCm38) missense probably benign 0.00
R9464:Pkhd1l1 UTSW 15 44,479,613 (GRCm38) missense probably damaging 1.00
R9525:Pkhd1l1 UTSW 15 44,584,926 (GRCm38) missense possibly damaging 0.88
R9542:Pkhd1l1 UTSW 15 44,546,888 (GRCm38) missense probably benign 0.12
R9544:Pkhd1l1 UTSW 15 44,546,843 (GRCm38) missense probably damaging 1.00
R9608:Pkhd1l1 UTSW 15 44,578,633 (GRCm38) missense possibly damaging 0.65
R9673:Pkhd1l1 UTSW 15 44,523,505 (GRCm38) missense probably benign 0.22
R9771:Pkhd1l1 UTSW 15 44,495,487 (GRCm38) missense probably benign
R9792:Pkhd1l1 UTSW 15 44,543,587 (GRCm38) missense probably benign 0.00
R9793:Pkhd1l1 UTSW 15 44,543,587 (GRCm38) missense probably benign 0.00
R9795:Pkhd1l1 UTSW 15 44,543,587 (GRCm38) missense probably benign 0.00
RF006:Pkhd1l1 UTSW 15 44,558,507 (GRCm38) critical splice acceptor site probably benign
RF006:Pkhd1l1 UTSW 15 44,503,238 (GRCm38) missense probably benign 0.03
RF008:Pkhd1l1 UTSW 15 44,558,505 (GRCm38) critical splice acceptor site probably benign
RF012:Pkhd1l1 UTSW 15 44,558,505 (GRCm38) critical splice acceptor site probably benign
RF019:Pkhd1l1 UTSW 15 44,558,507 (GRCm38) critical splice acceptor site probably benign
RF030:Pkhd1l1 UTSW 15 44,558,502 (GRCm38) critical splice acceptor site probably benign
RF033:Pkhd1l1 UTSW 15 44,558,506 (GRCm38) critical splice acceptor site probably benign
RF038:Pkhd1l1 UTSW 15 44,558,503 (GRCm38) critical splice acceptor site probably benign
RF046:Pkhd1l1 UTSW 15 44,558,495 (GRCm38) critical splice acceptor site probably benign
X0027:Pkhd1l1 UTSW 15 44,591,966 (GRCm38) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,578,578 (GRCm38) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,573,576 (GRCm38) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGAATAGGGGCTAGTACTGTCTC -3'
(R):5'- TGGAGCCTGTCTTCATACATTTAC -3'

Sequencing Primer
(F):5'- CTTGGCATTCAACTTTTTGGA -3'
(R):5'- CTTCTTTAAAGGATAGGGAGTGAACC -3'
Posted On 2015-12-29