Incidental Mutation 'R0412:Kcnk9'
ID36733
Institutional Source Beutler Lab
Gene Symbol Kcnk9
Ensembl Gene ENSMUSG00000036760
Gene Namepotassium channel, subfamily K, member 9
SynonymsTask3
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R0412 (G1)
Quality Score206
Status Validated
Chromosome15
Chromosomal Location72501089-72546340 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 72513056 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044624]
Predicted Effect probably benign
Transcript: ENSMUST00000044624
SMART Domains Protein: ENSMUSP00000038729
Gene: ENSMUSG00000036760

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
Pfam:Ion_trans_2 59 134 3.4e-20 PFAM
Pfam:Ion_trans_2 165 248 1.7e-18 PFAM
low complexity region 308 323 N/A INTRINSIC
low complexity region 325 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple transmembrane regions and two pore-forming P domains and functions as a pH-dependent potassium channel. Amplification and overexpression of this gene have been observed in several types of human carcinomas. This gene is imprinted in the brain, with preferential expression from the maternal allele. A mutation in this gene was associated with Birk-Barel mental retardation dysmorphism syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased pH sensitive action potential in serotonergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Kcnk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Kcnk9 APN 15 72546075 missense probably benign 0.25
IGL02569:Kcnk9 APN 15 72512577 missense probably benign 0.00
PIT4520001:Kcnk9 UTSW 15 72512483 missense probably benign 0.00
R1507:Kcnk9 UTSW 15 72512234 missense possibly damaging 0.59
R1780:Kcnk9 UTSW 15 72512401 missense unknown
R1800:Kcnk9 UTSW 15 72546099 missense probably benign 0.04
R2989:Kcnk9 UTSW 15 72512358 missense unknown
R4089:Kcnk9 UTSW 15 72546263 missense probably benign 0.40
R4710:Kcnk9 UTSW 15 72512975 missense probably damaging 1.00
R6375:Kcnk9 UTSW 15 72546243 missense probably benign 0.35
Z1088:Kcnk9 UTSW 15 72546015 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTTCAGCAGGTAGCGCACGAAG -3'
(R):5'- TAGGGAAGTGACTCCAGCGTCAAG -3'

Sequencing Primer
(F):5'- TAGCGCACGAAGGTGTTC -3'
(R):5'- ggaggtggaggtagggg -3'
Posted On2013-05-09