Incidental Mutation 'R4833:Tmc5'
ID372989
Institutional Source Beutler Lab
Gene Symbol Tmc5
Ensembl Gene ENSMUSG00000030650
Gene Nametransmembrane channel-like gene family 5
Synonyms4932443L08Rik
MMRRC Submission 042449-MU
Accession Numbers

Genbank: NM_001105252.1, NM_028930.3

Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4833 (G1)
Quality Score202
Status Validated
Chromosome7
Chromosomal Location118597297-118675086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118628829 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 307 (H307Q)
Ref Sequence ENSEMBL: ENSMUSP00000114137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057320] [ENSMUST00000098088] [ENSMUST00000121715] [ENSMUST00000121744]
Predicted Effect probably benign
Transcript: ENSMUST00000057320
SMART Domains Protein: ENSMUSP00000049784
Gene: ENSMUSG00000030650

DomainStartEndE-ValueType
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 371 393 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
Pfam:TMC 476 581 8.1e-44 PFAM
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 652 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098088
AA Change: H307Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095694
Gene: ENSMUSG00000030650
AA Change: H307Q

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.2e-42 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121715
AA Change: H307Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112434
Gene: ENSMUSG00000030650
AA Change: H307Q

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121744
AA Change: H307Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114137
Gene: ENSMUSG00000030650
AA Change: H307Q

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Meta Mutation Damage Score 0.2637 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C A 19: 3,716,872 T153K possibly damaging Het
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in Tmc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tmc5 APN 7 118656787 missense probably damaging 1.00
IGL01601:Tmc5 APN 7 118623824 unclassified probably benign
IGL01633:Tmc5 APN 7 118623586 missense probably damaging 0.97
IGL01845:Tmc5 APN 7 118652510 missense possibly damaging 0.93
IGL02148:Tmc5 APN 7 118645324 missense probably damaging 0.97
IGL02638:Tmc5 APN 7 118627233 missense probably benign 0.36
IGL02890:Tmc5 APN 7 118645430 splice site probably benign
hipster UTSW 7 118666611 critical splice donor site probably null
F5426:Tmc5 UTSW 7 118623323 missense probably benign
PIT4802001:Tmc5 UTSW 7 118672226 missense probably benign
R0068:Tmc5 UTSW 7 118634237 missense probably benign 0.44
R0470:Tmc5 UTSW 7 118639931 missense possibly damaging 0.68
R0520:Tmc5 UTSW 7 118666576 missense probably damaging 1.00
R0786:Tmc5 UTSW 7 118627210 missense possibly damaging 0.94
R1263:Tmc5 UTSW 7 118666870 missense probably damaging 1.00
R1269:Tmc5 UTSW 7 118666593 missense probably benign 0.30
R1486:Tmc5 UTSW 7 118673432 missense probably benign 0.02
R1702:Tmc5 UTSW 7 118672239 missense probably benign 0.00
R2188:Tmc5 UTSW 7 118654955 missense probably damaging 1.00
R3508:Tmc5 UTSW 7 118645395 missense probably benign 0.01
R3893:Tmc5 UTSW 7 118645369 missense probably damaging 1.00
R3927:Tmc5 UTSW 7 118652655 nonsense probably null
R4171:Tmc5 UTSW 7 118649587 missense probably damaging 0.99
R4279:Tmc5 UTSW 7 118674663 makesense probably null
R4554:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4555:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4557:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4845:Tmc5 UTSW 7 118642381 missense probably damaging 1.00
R4852:Tmc5 UTSW 7 118645339 missense probably benign 0.32
R5087:Tmc5 UTSW 7 118645386 missense possibly damaging 0.68
R5214:Tmc5 UTSW 7 118647932 missense probably damaging 1.00
R5723:Tmc5 UTSW 7 118672193 missense probably damaging 1.00
R5739:Tmc5 UTSW 7 118666611 critical splice donor site probably null
R5882:Tmc5 UTSW 7 118654919 missense probably damaging 0.99
R5946:Tmc5 UTSW 7 118670725 missense probably damaging 1.00
R6244:Tmc5 UTSW 7 118634214 missense possibly damaging 0.93
R6360:Tmc5 UTSW 7 118633966 start codon destroyed probably null 1.00
R6375:Tmc5 UTSW 7 118656814 missense probably damaging 1.00
R6458:Tmc5 UTSW 7 118645316 missense probably damaging 1.00
R6566:Tmc5 UTSW 7 118647844 missense probably damaging 1.00
R6681:Tmc5 UTSW 7 118669304 missense probably damaging 1.00
R7202:Tmc5 UTSW 7 118639956 missense possibly damaging 0.49
R7227:Tmc5 UTSW 7 118670666 missense possibly damaging 0.81
R7410:Tmc5 UTSW 7 118623597 nonsense probably null
R7562:Tmc5 UTSW 7 118623326 missense probably benign 0.10
R7808:Tmc5 UTSW 7 118669217 missense probably damaging 1.00
Z1177:Tmc5 UTSW 7 118623756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCTGACCACTGAGAGCAC -3'
(R):5'- TGTGCTGACCACTCACAATGG -3'

Sequencing Primer
(F):5'- GAGCACAGTCAGCCATTACGTG -3'
(R):5'- AATGGACCCCAGGTTCCGTTC -3'
Posted On2016-03-01