Incidental Mutation 'R4935:Adcyap1'
ID380331
Institutional Source Beutler Lab
Gene Symbol Adcyap1
Ensembl Gene ENSMUSG00000024256
Gene Nameadenylate cyclase activating polypeptide 1
SynonymsPACAP
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location93199422-93205485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93204113 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 172 (I172L)
Ref Sequence ENSEMBL: ENSMUSP00000067057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064775]
Predicted Effect probably benign
Transcript: ENSMUST00000064775
AA Change: I172L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000067057
Gene: ENSMUSG00000024256
AA Change: I172L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLUCA 82 108 3.4e-4 SMART
GLUCA 131 157 3.99e-10 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the glucagon superfamily of hormones that have important roles in growth and metabolism. The encoded protein undergoes proteolytic processing to generate mature peptides that function as hypophysiotropic hormones, neurotransmitters, neuromodulators and vasoregulators. Mice lacking the encoded protein exhibit a high rate of early mortality. The surviving adult animals lacking the encoded protein exhibit decreased anxiety, hyperactive behavior and impaired steroidogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high postnatal mortality, impaired thermoregulation, and loss of white fat. Survivors show ketosis, microvesicular fat accumulation, elevated serum lipids, and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Adcyap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Adcyap1 APN 17 93203964 missense probably benign 0.05
IGL01551:Adcyap1 APN 17 93204018 missense probably damaging 1.00
IGL01665:Adcyap1 APN 17 93200078 missense probably damaging 1.00
R0325:Adcyap1 UTSW 17 93202832 missense probably benign 0.00
R1459:Adcyap1 UTSW 17 93200122 critical splice donor site probably null
R2191:Adcyap1 UTSW 17 93200026 missense possibly damaging 0.88
R2348:Adcyap1 UTSW 17 93202274 missense possibly damaging 0.92
R4334:Adcyap1 UTSW 17 93202268 missense probably benign 0.10
R6329:Adcyap1 UTSW 17 93202799 missense probably benign
R6337:Adcyap1 UTSW 17 93202281 nonsense probably null
R7414:Adcyap1 UTSW 17 93202828 missense probably damaging 1.00
R7527:Adcyap1 UTSW 17 93202829 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCGACTCAATGTGTCTCCC -3'
(R):5'- GGTCCACAAAGTATATCTGTGCATTC -3'

Sequencing Primer
(F):5'- AATGTGTCTCCCGCCCCG -3'
(R):5'- AGTATATCTGTGCATTCTCTAGTGC -3'
Posted On2016-04-15