Incidental Mutation 'R4935:Znrf3'
ID380315
Institutional Source Beutler Lab
Gene Symbol Znrf3
Ensembl Gene ENSMUSG00000041961
Gene Namezinc and ring finger 3
SynonymsLOC382477
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4935 (G1)
Quality Score174
Status Not validated
Chromosome11
Chromosomal Location5276324-5444847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5283422 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 212 (C212S)
Ref Sequence ENSEMBL: ENSMUSP00000134698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109867] [ENSMUST00000172492]
Predicted Effect probably damaging
Transcript: ENSMUST00000109867
AA Change: C308S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105493
Gene: ENSMUSG00000041961
AA Change: C308S

DomainStartEndE-ValueType
signal peptide 1 52 N/A INTRINSIC
PDB:4CDK|D 53 205 1e-103 PDB
transmembrane domain 218 235 N/A INTRINSIC
RING 290 330 1.56e-6 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172492
AA Change: C212S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134698
Gene: ENSMUSG00000041961
AA Change: C212S

DomainStartEndE-ValueType
PDB:4CDK|D 2 109 5e-70 PDB
transmembrane domain 122 139 N/A INTRINSIC
RING 194 234 1.56e-6 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 449 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit complete lethality around birth, aphakia, abnormal lens development and defective enural tube closure in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Other mutations in Znrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Znrf3 APN 11 5289039 missense probably damaging 1.00
IGL01387:Znrf3 APN 11 5338656 nonsense probably null
IGL02895:Znrf3 APN 11 5289085 missense probably damaging 0.97
R0788:Znrf3 UTSW 11 5281320 missense probably benign 0.04
R1383:Znrf3 UTSW 11 5281994 missense probably damaging 0.96
R1544:Znrf3 UTSW 11 5289066 missense probably damaging 1.00
R1556:Znrf3 UTSW 11 5281347 missense probably benign 0.01
R1586:Znrf3 UTSW 11 5281477 missense probably damaging 1.00
R1852:Znrf3 UTSW 11 5287455 missense possibly damaging 0.94
R1864:Znrf3 UTSW 11 5283373 missense possibly damaging 0.95
R1927:Znrf3 UTSW 11 5281062 missense probably benign 0.28
R2353:Znrf3 UTSW 11 5281170 missense probably damaging 1.00
R2884:Znrf3 UTSW 11 5289693 missense probably damaging 1.00
R2885:Znrf3 UTSW 11 5289693 missense probably damaging 1.00
R4021:Znrf3 UTSW 11 5281278 missense possibly damaging 0.68
R4811:Znrf3 UTSW 11 5287420 missense probably benign 0.07
R5218:Znrf3 UTSW 11 5281519 missense possibly damaging 0.95
R5584:Znrf3 UTSW 11 5286218 missense probably damaging 1.00
R5698:Znrf3 UTSW 11 5289006 intron probably benign
R5715:Znrf3 UTSW 11 5286239 missense possibly damaging 0.91
R5900:Znrf3 UTSW 11 5282110 missense probably damaging 0.98
R5988:Znrf3 UTSW 11 5281776 missense probably damaging 1.00
R6253:Znrf3 UTSW 11 5280865 missense probably benign 0.14
R7057:Znrf3 UTSW 11 5282442 missense probably benign 0.00
R7062:Znrf3 UTSW 11 5281550 missense probably damaging 1.00
R7410:Znrf3 UTSW 11 5288955 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCTAAGGTCCACATCTGCAG -3'
(R):5'- CGAGCTAGGAACACTTAGGATCC -3'

Sequencing Primer
(F):5'- GTCCAGAAAACCATGCTGTGTTG -3'
(R):5'- CTTAGGATCCATCTTACAGCAGGG -3'
Posted On2016-04-15