Incidental Mutation 'R4968:Selplg'
ID384178
Institutional Source Beutler Lab
Gene Symbol Selplg
Ensembl Gene ENSMUSG00000048163
Gene Nameselectin, platelet (p-selectin) ligand
SynonymsPsgl-1, CD162, Psgl1
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4968 (G1)
Quality Score175
Status Not validated
Chromosome5
Chromosomal Location113818536-113832644 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113819726 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 173 (E173G)
Ref Sequence ENSEMBL: ENSMUSP00000098436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100874] [ENSMUST00000199109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100874
AA Change: E173G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098436
Gene: ENSMUSG00000048163
AA Change: E173G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
internal_repeat_2 130 182 2.38e-13 PROSPERO
internal_repeat_1 133 186 5.75e-16 PROSPERO
internal_repeat_1 193 246 5.75e-16 PROSPERO
internal_repeat_2 200 252 2.38e-13 PROSPERO
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198920
Predicted Effect probably benign
Transcript: ENSMUST00000199109
Predicted Effect probably benign
Transcript: ENSMUST00000201194
Predicted Effect probably benign
Transcript: ENSMUST00000201931
Predicted Effect probably benign
Transcript: ENSMUST00000202555
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that functions as a high affinity counter-receptor for the cell adhesion molecules P-, E- and L- selectin expressed on myeloid cells and stimulated T lymphocytes. As such, this protein plays a critical role in leukocyte trafficking during inflammation by tethering of leukocytes to activated platelets or endothelia expressing selectins. This protein requires two post-translational modifications, tyrosine sulfation and the addition of the sialyl Lewis x tetrasaccharide (sLex) to its O-linked glycans, for its high-affinity binding activity. Aberrant expression of this gene and polymorphisms in this gene are associated with defects in the innate and adaptive immune response. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neutrophillia and impaired leukocyte adhesion and rolling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Selplg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Selplg APN 5 113819468 missense probably damaging 1.00
IGL01488:Selplg APN 5 113819636 missense possibly damaging 0.78
IGL02355:Selplg APN 5 113819406 missense probably benign 0.00
IGL02362:Selplg APN 5 113819406 missense probably benign 0.00
PIT4142001:Selplg UTSW 5 113819628 missense probably benign 0.00
R0375:Selplg UTSW 5 113820008 missense probably damaging 0.99
R1222:Selplg UTSW 5 113819373 missense possibly damaging 0.95
R1840:Selplg UTSW 5 113819844 missense possibly damaging 0.66
R2925:Selplg UTSW 5 113820179 missense possibly damaging 0.92
R4512:Selplg UTSW 5 113819063 missense probably benign 0.05
R4702:Selplg UTSW 5 113819033 missense probably benign 0.31
R4703:Selplg UTSW 5 113819033 missense probably benign 0.31
R4704:Selplg UTSW 5 113819033 missense probably benign 0.31
R5075:Selplg UTSW 5 113819984 missense probably benign 0.00
R6159:Selplg UTSW 5 113819101 missense probably benign 0.02
R6345:Selplg UTSW 5 113820149 missense probably benign 0.03
R6550:Selplg UTSW 5 113820149 missense probably benign 0.03
R6554:Selplg UTSW 5 113820149 missense probably benign 0.03
R6997:Selplg UTSW 5 113819695 unclassified probably benign
R7050:Selplg UTSW 5 113819695 unclassified probably benign
R7094:Selplg UTSW 5 113819695 unclassified probably benign
R7235:Selplg UTSW 5 113819695 unclassified probably benign
R7481:Selplg UTSW 5 113819695 unclassified probably benign
R7604:Selplg UTSW 5 113819695 unclassified probably benign
R7674:Selplg UTSW 5 113819695 unclassified probably benign
R7846:Selplg UTSW 5 113819420 missense probably damaging 1.00
R7887:Selplg UTSW 5 113819695 unclassified probably benign
R7929:Selplg UTSW 5 113819420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCTGAATCCTGGGAAG -3'
(R):5'- GATGCTGAGCACAGACTCTG -3'

Sequencing Primer
(F):5'- CTGAATCCTGGGAAGCTGGG -3'
(R):5'- TGAGCACAGACTCTGCCACAC -3'
Posted On2016-04-27