Incidental Mutation 'R7887:Selplg'
ID609109
Institutional Source Beutler Lab
Gene Symbol Selplg
Ensembl Gene ENSMUSG00000048163
Gene Nameselectin, platelet (p-selectin) ligand
SynonymsPsgl-1, CD162, Psgl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7887 (G1)
Quality Score214.458
Status Not validated
Chromosome5
Chromosomal Location113818536-113832644 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT at 113819695 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000100874] [ENSMUST00000199109]
Predicted Effect probably benign
Transcript: ENSMUST00000100874
SMART Domains Protein: ENSMUSP00000098436
Gene: ENSMUSG00000048163

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
internal_repeat_2 130 182 2.38e-13 PROSPERO
internal_repeat_1 133 186 5.75e-16 PROSPERO
internal_repeat_1 193 246 5.75e-16 PROSPERO
internal_repeat_2 200 252 2.38e-13 PROSPERO
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199109
Predicted Effect probably benign
Transcript: ENSMUST00000201194
Predicted Effect probably benign
Transcript: ENSMUST00000201931
Predicted Effect probably benign
Transcript: ENSMUST00000202555
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that functions as a high affinity counter-receptor for the cell adhesion molecules P-, E- and L- selectin expressed on myeloid cells and stimulated T lymphocytes. As such, this protein plays a critical role in leukocyte trafficking during inflammation by tethering of leukocytes to activated platelets or endothelia expressing selectins. This protein requires two post-translational modifications, tyrosine sulfation and the addition of the sialyl Lewis x tetrasaccharide (sLex) to its O-linked glycans, for its high-affinity binding activity. Aberrant expression of this gene and polymorphisms in this gene are associated with defects in the innate and adaptive immune response. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neutrophillia and impaired leukocyte adhesion and rolling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
B4galt1 A G 4: 40,823,501 Y197H probably benign Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in Selplg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Selplg APN 5 113819468 missense probably damaging 1.00
IGL01488:Selplg APN 5 113819636 missense possibly damaging 0.78
IGL02355:Selplg APN 5 113819406 missense probably benign 0.00
IGL02362:Selplg APN 5 113819406 missense probably benign 0.00
PIT4142001:Selplg UTSW 5 113819628 missense probably benign 0.00
R0375:Selplg UTSW 5 113820008 missense probably damaging 0.99
R1222:Selplg UTSW 5 113819373 missense possibly damaging 0.95
R1840:Selplg UTSW 5 113819844 missense possibly damaging 0.66
R2925:Selplg UTSW 5 113820179 missense possibly damaging 0.92
R4512:Selplg UTSW 5 113819063 missense probably benign 0.05
R4702:Selplg UTSW 5 113819033 missense probably benign 0.31
R4703:Selplg UTSW 5 113819033 missense probably benign 0.31
R4704:Selplg UTSW 5 113819033 missense probably benign 0.31
R4968:Selplg UTSW 5 113819726 missense possibly damaging 0.93
R5075:Selplg UTSW 5 113819984 missense probably benign 0.00
R6159:Selplg UTSW 5 113819101 missense probably benign 0.02
R6345:Selplg UTSW 5 113820149 missense probably benign 0.03
R6550:Selplg UTSW 5 113820149 missense probably benign 0.03
R6554:Selplg UTSW 5 113820149 missense probably benign 0.03
R6997:Selplg UTSW 5 113819695 unclassified probably benign
R7050:Selplg UTSW 5 113819695 unclassified probably benign
R7094:Selplg UTSW 5 113819695 unclassified probably benign
R7235:Selplg UTSW 5 113819695 unclassified probably benign
R7481:Selplg UTSW 5 113819695 unclassified probably benign
R7604:Selplg UTSW 5 113819695 unclassified probably benign
R7674:Selplg UTSW 5 113819695 unclassified probably benign
R7846:Selplg UTSW 5 113819420 missense probably damaging 1.00
R8051:Selplg UTSW 5 113819441 missense probably damaging 0.99
Z1177:Selplg UTSW 5 113819351 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCTGCAGACGTTGTAAACAGAG -3'
(R):5'- GTGGAGTCTAACCTCAGTAGAGAC -3'

Sequencing Primer
(F):5'- TTTACAGCCTGAATCCTGGGAAGC -3'
(R):5'- GTCTAACCTCAGTAGAGACCGTCC -3'
Posted On2019-12-20