Incidental Mutation 'R4981:Myh1'
ID384853
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Namemyosin, heavy polypeptide 1, skeletal muscle, adult
SynonymsA530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
MMRRC Submission 042576-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4981 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67200052-67224575 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 67224474 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000075734] [ENSMUST00000124516]
Predicted Effect probably benign
Transcript: ENSMUST00000018637
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075734
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124516
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149070
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (105/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,048,987 probably null Het
Aatf T C 11: 84,511,497 D121G probably benign Het
Amer2 T A 14: 60,379,727 L331H probably damaging Het
Ang4 T G 14: 51,764,372 K40Q probably benign Het
Aspm A C 1: 139,470,760 probably null Het
Cacna1c A T 6: 118,751,471 D337E probably benign Het
Ccdc124 T C 8: 70,868,785 E134G probably benign Het
Ccdc7a G T 8: 128,984,983 A312E probably benign Het
Ccdc84 A T 9: 44,417,948 F14Y probably damaging Het
Cd209g A G 8: 4,136,845 D130G probably damaging Het
Cd320 T C 17: 33,847,575 S96P probably benign Het
Clu C G 14: 65,973,366 Q134E probably damaging Het
Cnksr3 T A 10: 7,160,777 H28L probably benign Het
Cntnap1 T C 11: 101,176,333 probably null Het
Col22a1 C T 15: 71,861,066 C546Y unknown Het
Col6a3 C T 1: 90,778,843 V2183I unknown Het
Cop1 A G 1: 159,325,068 probably benign Het
Cpne8 T C 15: 90,679,235 I24V probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Dennd5b G A 6: 149,009,772 L978F possibly damaging Het
Depdc1a G T 3: 159,523,913 M627I probably benign Het
Dnah3 A T 7: 119,956,201 N2721K probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg1b A G 18: 20,408,868 T811A possibly damaging Het
Emilin1 C G 5: 30,919,351 Q847E probably benign Het
Epha3 A T 16: 63,652,412 V370D probably benign Het
Epha5 T A 5: 84,150,483 T406S probably damaging Het
Ephb1 A T 9: 102,040,960 I450N probably benign Het
Ephb2 A G 4: 136,696,010 M319T probably benign Het
Eps15l1 A G 8: 72,378,989 probably null Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fgd5 T C 6: 91,989,300 I838T probably damaging Het
Fnbp4 T C 2: 90,765,830 F582L probably damaging Het
Frs3 T C 17: 47,689,262 probably null Het
Fscb C T 12: 64,473,619 V358I possibly damaging Het
Fus G T 7: 127,967,555 probably benign Het
Fyb CCTCTCTCTCTCTCTCTCTCT CCTCTCTCTCTCTCTCTCT 15: 6,646,611 probably benign Het
Glra3 A T 8: 55,991,235 I77F possibly damaging Het
Gm4454 C T 7: 38,570,436 noncoding transcript Het
Gng3 G A 19: 8,838,261 A37V possibly damaging Het
Grin3b T A 10: 79,976,357 probably benign Het
Herpud1 A G 8: 94,391,794 Y41C probably damaging Het
Igkv4-92 G C 6: 68,755,044 S115R possibly damaging Het
Ikbip T A 10: 91,095,986 I164N probably benign Het
Kank1 A G 19: 25,411,395 T783A probably benign Het
Kcnq3 A T 15: 66,031,405 V152E possibly damaging Het
Kif23 C T 9: 61,931,871 R314H probably damaging Het
Klc4 T C 17: 46,644,361 H49R probably benign Het
Klhl20 A T 1: 161,103,005 I309N possibly damaging Het
Lgals4 A G 7: 28,841,276 Y268C probably damaging Het
Lingo4 A G 3: 94,399,454 Q13R probably benign Het
Lmtk2 C A 5: 144,176,447 F1328L probably damaging Het
Mapk14 A G 17: 28,741,791 R179G probably damaging Het
Mbd3l1 A T 9: 18,484,905 T109S probably benign Het
Megf6 T C 4: 154,267,450 F1169L possibly damaging Het
Mrgpra1 A T 7: 47,335,211 V240D probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nav3 T C 10: 109,880,692 I172V probably benign Het
Nemp1 T A 10: 127,693,530 L178Q probably damaging Het
Numa1 T C 7: 101,992,674 S110P probably damaging Het
Olfr1076 T C 2: 86,508,827 Y123H probably damaging Het
Olfr1222 T C 2: 89,125,501 T77A probably benign Het
Olfr1248 A G 2: 89,617,425 Y256H probably damaging Het
Olfr1500 A T 19: 13,828,094 F101I probably damaging Het
Olfr639 A G 7: 104,012,105 I199T probably damaging Het
Olfr995 A G 2: 85,438,469 S230P probably damaging Het
Pard3b T G 1: 62,344,060 M771R probably damaging Het
Phkg2 A G 7: 127,582,379 I245V probably damaging Het
Pik3cg A T 12: 32,204,104 M628K possibly damaging Het
Poln A G 5: 34,107,085 probably null Het
Ppip5k1 A T 2: 121,312,390 S1172T probably damaging Het
Prdm5 A T 6: 65,870,462 H363L probably damaging Het
Prkdc A G 16: 15,678,309 Y788C probably damaging Het
Prrc2c T A 1: 162,692,547 R2076S probably damaging Het
Sh2d2a A G 3: 87,849,421 Y191C probably damaging Het
Slc20a1 T C 2: 129,199,999 I94T probably damaging Het
Sptbn2 T C 19: 4,751,658 V2366A probably benign Het
Stab2 T A 10: 86,960,223 M387L probably benign Het
Syne2 T G 12: 75,941,219 M1718R probably damaging Het
Synm G T 7: 67,734,487 F700L probably benign Het
Tmco4 T C 4: 138,990,701 F51L possibly damaging Het
Tmem104 C A 11: 115,205,136 P168T probably damaging Het
Tril G T 6: 53,818,920 T439K probably benign Het
Trim2 A G 3: 84,177,735 L559P probably damaging Het
Trim3 A G 7: 105,619,128 V149A probably damaging Het
Triml2 A G 8: 43,187,680 N191S probably benign Het
Usp4 A G 9: 108,381,418 D16G probably benign Het
Vmn2r58 G A 7: 41,837,461 T670I probably damaging Het
Vmn2r97 G T 17: 18,940,174 G524* probably null Het
Xpo5 C A 17: 46,220,817 F426L probably damaging Het
Zfp800 A G 6: 28,247,191 L84S probably damaging Het
Zranb2 T G 3: 157,546,741 probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67205925 missense probably benign
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2189:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2483:Myh1 UTSW 11 67211226 missense probably benign
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R3829:Myh1 UTSW 11 67205597 missense probably benign 0.01
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R5870:Myh1 UTSW 11 67201979 missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6813:Myh1 UTSW 11 67220460 missense probably benign 0.34
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7384:Myh1 UTSW 11 67224375 missense possibly damaging 0.46
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7447:Myh1 UTSW 11 67219180 missense probably benign 0.01
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8060:Myh1 UTSW 11 67215251 missense probably benign
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTACTCACAGGAGGAACAATC -3'
(R):5'- CCATGCTTAACCTGGGTGAC -3'

Sequencing Primer
(F):5'- GGAACAATCCAATGTCAACCTGG -3'
(R):5'- CATGCTTAACCTGGGTGACTAAGG -3'
Posted On2016-05-10