Incidental Mutation 'R9378:Myh1'
ID 709799
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Name myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms A530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9378 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67200052-67224575 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 67202433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 117 (T117P)
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000018641] [ENSMUST00000075734] [ENSMUST00000124516] [ENSMUST00000129018] [ENSMUST00000170159]
AlphaFold Q5SX40
Predicted Effect probably damaging
Transcript: ENSMUST00000018637
AA Change: T117P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: T117P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018641
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075734
AA Change: T117P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: T117P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124516
AA Change: T117P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: T117P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129018
SMART Domains Protein: ENSMUSP00000115583
Gene: ENSMUSG00000056328

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170159
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2210408I21Rik A G 13: 77,323,616 K1047E possibly damaging Het
Abca14 A T 7: 120,207,968 Y79F possibly damaging Het
Abca2 T A 2: 25,439,082 M978K probably benign Het
Adamts3 A T 5: 89,700,410 C684* probably null Het
Adnp2 T C 18: 80,129,422 T591A probably benign Het
Aff4 A T 11: 53,372,479 T109S probably damaging Het
Agmo A G 12: 37,243,721 I48V probably benign Het
Appl1 G A 14: 26,927,827 R581* probably null Het
Armc9 A T 1: 86,262,044 M714L probably benign Het
Atp6v0d2 T A 4: 19,922,377 T41S probably benign Het
Bin1 A T 18: 32,419,868 Q182L probably damaging Het
Bmp10 A G 6: 87,433,702 D159G probably benign Het
Bsn G A 9: 108,107,655 P295S possibly damaging Het
C130079G13Rik A G 3: 59,931,689 T11A possibly damaging Het
Cbx6 A G 15: 79,828,405 S274P probably damaging Het
Cdc20b A G 13: 113,056,097 K108R probably benign Het
Ces1d T A 8: 93,186,096 N238I probably damaging Het
Col7a1 C T 9: 108,958,640 Q663* probably null Het
Cpsf3 T C 12: 21,308,038 I517T possibly damaging Het
Cyp2a5 C A 7: 26,840,454 T309N probably damaging Het
Cyp2d40 A G 15: 82,761,601 F68L possibly damaging Het
Cyp7b1 A T 3: 18,096,673 W301R probably damaging Het
Dnah6 T A 6: 73,212,530 N45I probably benign Het
Dnah7a A T 1: 53,582,617 H1116Q probably benign Het
Dntt A G 19: 41,038,917 N141S probably benign Het
Fbxl13 T C 5: 21,585,203 N281D probably damaging Het
Frem2 A T 3: 53,651,989 L1699H probably damaging Het
Gabrr3 T C 16: 59,461,674 V464A possibly damaging Het
Gdap1 T A 1: 17,157,129 I160N probably damaging Het
Hnrnpll C A 17: 80,061,862 R44L unknown Het
Hsp90ab1 T C 17: 45,570,754 E187G probably damaging Het
Ighm T A 12: 113,422,590 T47S Het
Itgb7 A C 15: 102,227,396 probably null Het
Kif16b A T 2: 142,619,818 C1293* probably null Het
Klf11 C T 12: 24,655,044 R166C probably benign Het
Lca5l T A 16: 96,176,012 Q198L probably damaging Het
Lnx2 A T 5: 147,024,370 M584K probably benign Het
Lpp A T 16: 24,721,987 M1L probably benign Het
Lrig3 A G 10: 125,997,084 T276A probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Megf8 A T 7: 25,340,415 probably null Het
Neb C A 2: 52,244,101 R3290L possibly damaging Het
Neb A C 2: 52,247,292 V220G Het
Nktr A T 9: 121,748,198 K444I probably damaging Het
Nol11 A T 11: 107,173,679 M483K probably benign Het
Npy1r C A 8: 66,704,209 P94T probably damaging Het
Nsmaf T C 4: 6,440,940 T37A probably benign Het
Olfr1137 C A 2: 87,711,079 V276F possibly damaging Het
Olfr1224-ps1 T C 2: 89,157,055 N40S probably damaging Het
Olfr131 G A 17: 38,082,165 A271V possibly damaging Het
Olfr160 A G 9: 37,712,177 I34T probably damaging Het
Olfr286 A G 15: 98,227,039 L204P possibly damaging Het
Olfr624 A T 7: 103,670,182 M283K probably damaging Het
Olfr884 G A 9: 38,047,479 V86M possibly damaging Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pcdha3 A G 18: 36,947,231 D342G probably damaging Het
Pclo G A 5: 14,765,863 V1266I Het
Pcnx4 T C 12: 72,555,890 Y309H probably damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pdzrn3 T G 6: 101,150,811 K965Q probably damaging Het
Phldb1 G A 9: 44,704,128 A225V probably benign Het
Plat A G 8: 22,775,583 Y214C probably damaging Het
Plppr1 T A 4: 49,325,627 C274* probably null Het
Poglut1 A G 16: 38,526,771 F345L possibly damaging Het
Ppara A T 15: 85,777,636 E26V possibly damaging Het
Ppcdc A T 9: 57,420,288 W79R probably damaging Het
Prdm1 C T 10: 44,440,154 C662Y probably damaging Het
Sgms2 G A 3: 131,342,362 probably benign Het
Slc31a1 T A 4: 62,388,606 M133K probably damaging Het
Smg1 G A 7: 118,178,775 Q1309* probably null Het
Sos1 T C 17: 80,453,810 I152M probably damaging Het
Stk4 A T 2: 164,110,216 probably benign Het
Syne1 T G 10: 5,250,954 N3538T probably damaging Het
Tbc1d16 A G 11: 119,208,840 F236S probably damaging Het
Tgs1 T A 4: 3,595,475 M548K probably benign Het
Twf1 G A 15: 94,585,455 T124I probably damaging Het
Tyro3 G A 2: 119,812,167 G611R probably damaging Het
Unc13b T A 4: 43,173,282 I1370K unknown Het
Usp40 A G 1: 87,957,310 W939R probably damaging Het
Vamp8 A T 6: 72,385,571 V82E probably damaging Het
Vmn2r17 A G 5: 109,427,866 H201R possibly damaging Het
Whrn T C 4: 63,431,842 H546R probably benign Het
Yeats2 T C 16: 20,214,478 V1036A probably benign Het
Zfp352 T G 4: 90,224,338 N238K probably benign Het
Zfp36l3 TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG TCCAGG X: 53,774,554 probably benign Het
Zfp462 T A 4: 55,011,510 S1159T probably benign Het
Zscan4-ps1 A T 7: 11,066,265 H232Q probably benign Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
compelling UTSW 11 67219805 critical splice donor site probably null
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
G1patch:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67205925 missense probably benign
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2189:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2483:Myh1 UTSW 11 67211226 missense probably benign
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R3829:Myh1 UTSW 11 67205597 missense probably benign 0.01
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R4981:Myh1 UTSW 11 67224474 utr 3 prime probably benign
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R5870:Myh1 UTSW 11 67201979 missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6813:Myh1 UTSW 11 67220460 missense probably benign 0.34
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7384:Myh1 UTSW 11 67224375 missense possibly damaging 0.46
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7447:Myh1 UTSW 11 67219180 missense probably benign 0.01
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8060:Myh1 UTSW 11 67215251 missense probably benign
R8080:Myh1 UTSW 11 67211402 missense probably benign 0.10
R8117:Myh1 UTSW 11 67222205 missense probably damaging 1.00
R8171:Myh1 UTSW 11 67202572 missense probably damaging 1.00
R8183:Myh1 UTSW 11 67202006 missense possibly damaging 0.50
R8397:Myh1 UTSW 11 67221639 missense probably damaging 0.97
R8545:Myh1 UTSW 11 67202201 missense probably benign 0.00
R8807:Myh1 UTSW 11 67220528 missense probably benign 0.02
R8812:Myh1 UTSW 11 67209141 missense probably benign 0.00
R8855:Myh1 UTSW 11 67211421 missense probably damaging 1.00
R8906:Myh1 UTSW 11 67205913 missense probably benign 0.02
R8959:Myh1 UTSW 11 67211502 missense probably benign
R8992:Myh1 UTSW 11 67205781 missense probably benign
R9140:Myh1 UTSW 11 67209263 missense probably benign 0.04
R9293:Myh1 UTSW 11 67209103 missense probably benign 0.25
R9366:Myh1 UTSW 11 67219288 missense probably damaging 1.00
R9371:Myh1 UTSW 11 67219805 critical splice donor site probably null
R9482:Myh1 UTSW 11 67217919 missense probably damaging 1.00
R9507:Myh1 UTSW 11 67211223 missense probably benign 0.00
R9558:Myh1 UTSW 11 67217792 missense possibly damaging 0.90
R9561:Myh1 UTSW 11 67217792 missense possibly damaging 0.90
R9587:Myh1 UTSW 11 67211370 missense probably benign 0.03
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Z1187:Myh1 UTSW 11 67204446 missense probably benign
Z1188:Myh1 UTSW 11 67204446 missense probably benign
Z1190:Myh1 UTSW 11 67204446 missense probably benign
Z1191:Myh1 UTSW 11 67204446 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGATCAGGTCTACCCCATGAAC -3'
(R):5'- TTGTGCCACTCACCTGTCAG -3'

Sequencing Primer
(F):5'- TGATGACCCACCTGCATGAG -3'
(R):5'- TCACCTGTCAGCATGAACTGGTAG -3'
Posted On 2022-04-18