Incidental Mutation 'R5870:Myh1'
ID455141
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Namemyosin, heavy polypeptide 1, skeletal muscle, adult
SynonymsA530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67200052-67224575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67201979 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 33 (D33G)
Ref Sequence ENSEMBL: ENSMUSP00000115583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000018641] [ENSMUST00000075734] [ENSMUST00000124516] [ENSMUST00000129018] [ENSMUST00000170159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018637
AA Change: D33G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: D33G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018641
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075734
AA Change: D33G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: D33G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124516
AA Change: D33G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: D33G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129018
AA Change: D33G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115583
Gene: ENSMUSG00000056328
AA Change: D33G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145346
Predicted Effect probably benign
Transcript: ENSMUST00000170159
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.3998 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67205925 missense probably benign
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2189:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2483:Myh1 UTSW 11 67211226 missense probably benign
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R3829:Myh1 UTSW 11 67205597 missense probably benign 0.01
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R4981:Myh1 UTSW 11 67224474 utr 3 prime probably benign
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6813:Myh1 UTSW 11 67220460 missense probably benign 0.34
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7384:Myh1 UTSW 11 67224375 missense possibly damaging 0.46
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7447:Myh1 UTSW 11 67219180 missense probably benign 0.01
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8060:Myh1 UTSW 11 67215251 missense probably benign
R8080:Myh1 UTSW 11 67211402 missense probably benign 0.10
R8117:Myh1 UTSW 11 67222205 missense probably damaging 1.00
R8171:Myh1 UTSW 11 67202572 missense probably damaging 1.00
R8183:Myh1 UTSW 11 67202006 missense possibly damaging 0.50
R8397:Myh1 UTSW 11 67221639 missense probably damaging 0.97
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTAACTGTCAGGGAATG -3'
(R):5'- GGTTCATGGGGTAGACCTGATC -3'

Sequencing Primer
(F):5'- TGGGCTGCAACCAATAG -3'
(R):5'- ATGGGGTAGACCTGATCATCTTTTAC -3'
Posted On2017-02-10