Incidental Mutation 'R5034:Pde2a'
ID389446
Institutional Source Beutler Lab
Gene Symbol Pde2a
Ensembl Gene ENSMUSG00000110195
Gene Namephosphodiesterase 2A, cGMP-stimulated
Synonyms
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101421691-101512827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101502024 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 285 (D285G)
Ref Sequence ENSEMBL: ENSMUSP00000147553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084894] [ENSMUST00000163751] [ENSMUST00000166652] [ENSMUST00000209537] [ENSMUST00000210364] [ENSMUST00000211368]
Predicted Effect probably benign
Transcript: ENSMUST00000084894
AA Change: D301G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081956
Gene: ENSMUSG00000030653
AA Change: D301G

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163751
AA Change: D275G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131553
Gene: ENSMUSG00000110195
AA Change: D275G

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 386 2.22e-17 SMART
GAF 408 557 6.11e-38 SMART
HDc 652 821 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166652
AA Change: D275G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127521
Gene: ENSMUSG00000110195
AA Change: D275G

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209315
Predicted Effect probably benign
Transcript: ENSMUST00000209537
AA Change: D285G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000210364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211051
Predicted Effect probably benign
Transcript: ENSMUST00000211368
AA Change: D275G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0954 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E17 and E18; another knock out mutation results in only some animals surviving to weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Pde2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Pde2a APN 7 101484589 nonsense probably null
IGL00731:Pde2a APN 7 101508099 missense probably benign 0.04
IGL00807:Pde2a APN 7 101504412 missense probably damaging 1.00
IGL01339:Pde2a APN 7 101507159 missense probably benign
IGL01503:Pde2a APN 7 101501936 splice site probably benign
IGL01646:Pde2a APN 7 101507711 missense possibly damaging 0.95
IGL01960:Pde2a APN 7 101504740 missense probably benign 0.40
IGL02281:Pde2a APN 7 101481392 missense probably benign 0.34
IGL02318:Pde2a APN 7 101503343 missense possibly damaging 0.79
IGL02479:Pde2a APN 7 101501083 missense probably damaging 1.00
IGL02632:Pde2a APN 7 101504656 missense probably damaging 1.00
IGL02725:Pde2a APN 7 101507218 missense probably null 0.00
IGL02888:Pde2a APN 7 101505069 missense probably damaging 0.98
IGL03027:Pde2a APN 7 101481420 missense probably benign 0.01
IGL03114:Pde2a APN 7 101508683 splice site probably benign
PIT1430001:Pde2a UTSW 7 101451477 splice site probably benign
PIT4131001:Pde2a UTSW 7 101511154 missense probably damaging 0.98
PIT4431001:Pde2a UTSW 7 101501897 missense probably damaging 1.00
R1170:Pde2a UTSW 7 101484543 missense probably benign 0.00
R1298:Pde2a UTSW 7 101507202 missense probably benign 0.12
R1300:Pde2a UTSW 7 101510404 missense possibly damaging 0.48
R1451:Pde2a UTSW 7 101421991 nonsense probably null
R1731:Pde2a UTSW 7 101501660 missense probably damaging 1.00
R1863:Pde2a UTSW 7 101511154 missense probably damaging 1.00
R2258:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2259:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2260:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R4179:Pde2a UTSW 7 101481383 makesense probably null
R4688:Pde2a UTSW 7 101502834 missense probably benign
R4717:Pde2a UTSW 7 101494672 missense probably benign 0.00
R4723:Pde2a UTSW 7 101494618 missense possibly damaging 0.80
R4758:Pde2a UTSW 7 101511499 missense probably damaging 1.00
R4965:Pde2a UTSW 7 101502933 missense probably benign 0.01
R5219:Pde2a UTSW 7 101504604 missense probably damaging 1.00
R5533:Pde2a UTSW 7 101505980 missense probably damaging 0.97
R6083:Pde2a UTSW 7 101502879 missense possibly damaging 0.93
R6114:Pde2a UTSW 7 101511112 critical splice acceptor site probably null
R6365:Pde2a UTSW 7 101510363 missense probably damaging 1.00
R6372:Pde2a UTSW 7 101481392 missense probably benign 0.34
R6395:Pde2a UTSW 7 101501035 missense probably benign 0.00
R6482:Pde2a UTSW 7 101501037 missense probably benign 0.11
R6492:Pde2a UTSW 7 101500442 missense possibly damaging 0.71
R6971:Pde2a UTSW 7 101510313 nonsense probably null
R7027:Pde2a UTSW 7 101511597 missense probably damaging 1.00
R7082:Pde2a UTSW 7 101508096 missense probably damaging 1.00
R7107:Pde2a UTSW 7 101421968 missense probably benign 0.01
R7142:Pde2a UTSW 7 101504650 missense probably damaging 1.00
R7203:Pde2a UTSW 7 101509944 missense possibly damaging 0.70
R7231:Pde2a UTSW 7 101505953 missense probably damaging 0.99
R7248:Pde2a UTSW 7 101503390 missense possibly damaging 0.88
R7570:Pde2a UTSW 7 101502834 missense probably benign 0.03
R7632:Pde2a UTSW 7 101484594 missense possibly damaging 0.64
R7658:Pde2a UTSW 7 101511581 missense possibly damaging 0.79
R8061:Pde2a UTSW 7 101503972 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TCTGTTCAGATTGGGACACCC -3'
(R):5'- GACAGGGCTCCTTCGTAATTC -3'

Sequencing Primer
(F):5'- CAGAGAGGCTAGCGGGTGTTC -3'
(R):5'- AGGGCTCCTTCGTAATTCTTCTAAG -3'
Posted On2016-06-06