Incidental Mutation 'R5027:Muc6'
ID 391427
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Name mucin 6, gastric
Synonyms
MMRRC Submission 042618-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R5027 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 141213373-141241641 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 141216349 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2710 (I2710F)
Ref Sequence ENSEMBL: ENSMUSP00000049941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000003038
SMART Domains Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 590 1.7e-147 PFAM
low complexity region 646 659 N/A INTRINSIC
low complexity region 661 684 N/A INTRINSIC
Alpha_adaptinC2 706 819 1.45e-26 SMART
Pfam:Alpha_adaptin_C 825 933 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062451
AA Change: I2710F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: I2710F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190907
AA Change: I2775F
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: I2775F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 119,911,505 (GRCm39) I1363R probably benign Het
Abcc1 T C 16: 14,221,917 (GRCm39) probably null Het
Adgrf1 T A 17: 43,614,638 (GRCm39) F241I probably damaging Het
Afg3l1 T C 8: 124,216,553 (GRCm39) M264T probably benign Het
Ankle1 T C 8: 71,861,623 (GRCm39) S434P probably damaging Het
Apoe C T 7: 19,430,940 (GRCm39) A101T probably damaging Het
Apol11a G T 15: 77,401,153 (GRCm39) K213N probably damaging Het
Asap2 A G 12: 21,254,082 (GRCm39) M198V probably damaging Het
Atg4b C T 1: 93,714,297 (GRCm39) A360V probably benign Het
B3gnt5 T A 16: 19,588,444 (GRCm39) V221D probably damaging Het
Baz2b A T 2: 59,928,988 (GRCm39) probably benign Het
Cep350 C A 1: 155,809,100 (GRCm39) W492L probably benign Het
Cln6 A G 9: 62,754,375 (GRCm39) Y139C probably damaging Het
Col16a1 C T 4: 129,972,988 (GRCm39) T643M probably benign Het
Cul9 C T 17: 46,811,708 (GRCm39) E2507K probably damaging Het
Dgkz A T 2: 91,775,888 (GRCm39) V125D probably benign Het
Dnah17 T C 11: 117,993,365 (GRCm39) M1127V probably benign Het
Dnajb1 C A 8: 84,336,732 (GRCm39) D67E probably benign Het
Dync1li1 A G 9: 114,542,612 (GRCm39) D258G probably damaging Het
Egflam G T 15: 7,283,125 (GRCm39) P311T probably benign Het
Fbxw11 T A 11: 32,602,811 (GRCm39) probably benign Het
Fn3krp T G 11: 121,320,274 (GRCm39) D206E probably benign Het
Fsip2 A G 2: 82,819,477 (GRCm39) H5070R possibly damaging Het
Gm6605 T C 7: 38,149,683 (GRCm39) noncoding transcript Het
Gna14 C A 19: 16,580,636 (GRCm39) T158K probably benign Het
Gstt2 A T 10: 75,667,726 (GRCm39) I243N probably damaging Het
Haus6 C T 4: 86,523,933 (GRCm39) D50N possibly damaging Het
Hcrtr2 A G 9: 76,230,578 (GRCm39) I70T probably benign Het
Herc1 G A 9: 66,380,811 (GRCm39) V3563I probably benign Het
Herc1 A T 9: 66,411,900 (GRCm39) I4707F probably damaging Het
Hic2 C T 16: 17,076,611 (GRCm39) A480V possibly damaging Het
Hsd17b3 A G 13: 64,210,720 (GRCm39) Y212H probably damaging Het
Hspa5 A G 2: 34,665,827 (GRCm39) K557R probably damaging Het
Iqch T C 9: 63,432,294 (GRCm39) E367G possibly damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Lars2 A G 9: 123,270,560 (GRCm39) M551V probably benign Het
Lbp T C 2: 158,150,646 (GRCm39) I57T possibly damaging Het
Liat1 A G 11: 75,891,047 (GRCm39) K54E probably damaging Het
Litaf T C 16: 10,778,868 (GRCm39) Q142R possibly damaging Het
Lpar5 G C 6: 125,059,110 (GRCm39) R277P possibly damaging Het
Myo7b T A 18: 32,108,265 (GRCm39) I1199F probably benign Het
Naca A C 10: 127,883,990 (GRCm39) E2140D possibly damaging Het
Nup214 G T 2: 31,881,329 (GRCm39) G396C probably damaging Het
Or2v1 A T 11: 49,025,451 (GRCm39) Q144L probably benign Het
Or5aq7 T A 2: 86,938,150 (GRCm39) I194F probably benign Het
Or5j3 G A 2: 86,128,540 (GRCm39) V127I possibly damaging Het
Or7g33 A G 9: 19,448,573 (GRCm39) Y218H probably damaging Het
Or8b57 A T 9: 40,003,690 (GRCm39) S187T probably damaging Het
P4htm A G 9: 108,456,492 (GRCm39) V436A probably benign Het
Pfkm A G 15: 98,017,307 (GRCm39) I117V possibly damaging Het
Phlpp1 T G 1: 106,209,201 (GRCm39) V518G probably damaging Het
Piwil4 G A 9: 14,621,240 (GRCm39) L598F probably damaging Het
Polr1b T G 2: 128,965,803 (GRCm39) I815R possibly damaging Het
Ppef2 T C 5: 92,382,150 (GRCm39) N515S probably damaging Het
Prp2rt A G 13: 97,235,648 (GRCm39) I33T probably benign Het
Prpsap2 G T 11: 61,631,830 (GRCm39) probably null Het
Rab27a A G 9: 73,002,695 (GRCm39) D208G probably benign Het
Ralgds A G 2: 28,442,102 (GRCm39) probably null Het
Raph1 C A 1: 60,535,436 (GRCm39) C540F probably damaging Het
Rbsn A G 6: 92,175,231 (GRCm39) L281P probably damaging Het
Rigi T A 4: 40,208,845 (GRCm39) M756L probably benign Het
Rmdn1 G T 4: 19,588,533 (GRCm39) G110* probably null Het
Rph3a T A 5: 121,092,512 (GRCm39) E363V possibly damaging Het
Serpina16 G T 12: 103,641,262 (GRCm39) Y154* probably null Het
Sh2d3c G A 2: 32,634,814 (GRCm39) E198K possibly damaging Het
Shank2 C A 7: 143,812,842 (GRCm39) Y663* probably null Het
Sharpin T C 15: 76,234,225 (GRCm39) probably benign Het
Slitrk1 G A 14: 109,149,740 (GRCm39) P324S probably benign Het
Sorbs2 T A 8: 46,199,571 (GRCm39) probably null Het
Spag16 C T 1: 69,962,963 (GRCm39) probably benign Het
Sycp2l A T 13: 41,283,247 (GRCm39) probably null Het
Synj1 A T 16: 90,737,407 (GRCm39) probably null Het
Sytl1 T C 4: 132,983,530 (GRCm39) probably benign Het
Tkfc A T 19: 10,570,023 (GRCm39) probably null Het
Tnn T C 1: 159,972,781 (GRCm39) T274A probably damaging Het
Trav14-2 T A 14: 53,878,505 (GRCm39) W35R probably damaging Het
Trim72 T C 7: 127,607,137 (GRCm39) M222T probably damaging Het
Trim9 A G 12: 70,393,482 (GRCm39) V154A probably damaging Het
Ttc7b T C 12: 100,268,001 (GRCm39) Y266C probably damaging Het
Uchl3 T A 14: 101,903,982 (GRCm39) I43K possibly damaging Het
Vdac1 T A 11: 52,279,305 (GRCm39) N269K possibly damaging Het
Wdr72 T A 9: 74,053,258 (GRCm39) W187R probably damaging Het
Zfp30 T A 7: 29,492,491 (GRCm39) C248* probably null Het
Zfp940 A T 7: 29,550,381 (GRCm39) probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL00466:Muc6 APN 7 141,232,169 (GRCm39) missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141,638,890 (GRCm38) missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141,234,333 (GRCm39) nonsense probably null
IGL01021:Muc6 APN 7 141,217,075 (GRCm39) missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141,234,720 (GRCm39) missense probably damaging 1.00
IGL01294:Muc6 APN 7 141,232,926 (GRCm39) missense probably damaging 1.00
IGL01449:Muc6 APN 7 141,218,527 (GRCm39) missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141,237,572 (GRCm39) missense probably damaging 1.00
IGL01539:Muc6 APN 7 141,236,306 (GRCm39) missense probably benign 0.07
IGL01541:Muc6 APN 7 141,236,069 (GRCm39) nonsense probably null
IGL01810:Muc6 APN 7 141,237,327 (GRCm39) missense probably damaging 0.97
IGL01941:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL01954:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL02096:Muc6 APN 7 141,226,117 (GRCm39) intron probably benign
IGL02192:Muc6 APN 7 141,217,717 (GRCm39) missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141,235,889 (GRCm39) missense probably damaging 1.00
IGL02234:Muc6 APN 7 141,226,842 (GRCm39) missense probably benign 0.09
IGL02302:Muc6 APN 7 141,227,763 (GRCm39) missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141,226,726 (GRCm39) missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141,216,853 (GRCm39) missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141,235,843 (GRCm39) splice site probably benign
IGL02851:Muc6 APN 7 141,234,627 (GRCm39) missense probably damaging 1.00
IGL03026:Muc6 APN 7 141,226,414 (GRCm39) intron probably benign
IGL03070:Muc6 APN 7 141,230,834 (GRCm39) splice site probably benign
IGL03108:Muc6 APN 7 141,217,402 (GRCm39) missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141,238,324 (GRCm39) missense probably damaging 1.00
IGL03366:Muc6 APN 7 141,234,349 (GRCm39) missense probably damaging 1.00
anticipation UTSW 7 141,214,363 (GRCm39) frame shift probably null
F5770:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R0153:Muc6 UTSW 7 141,214,029 (GRCm39) missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141,216,868 (GRCm39) missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141,238,548 (GRCm39) missense probably benign 0.01
R0499:Muc6 UTSW 7 141,226,735 (GRCm39) missense probably benign
R0503:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141,218,497 (GRCm39) missense probably benign 0.06
R0792:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0880:Muc6 UTSW 7 141,217,270 (GRCm39) missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141,230,500 (GRCm39) missense probably damaging 0.99
R1174:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1175:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1189:Muc6 UTSW 7 141,232,122 (GRCm39) missense probably damaging 1.00
R1259:Muc6 UTSW 7 141,226,464 (GRCm39) intron probably benign
R1293:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R1295:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1296:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1471:Muc6 UTSW 7 141,234,176 (GRCm39) missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1548:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1548:Muc6 UTSW 7 141,238,368 (GRCm39) splice site probably benign
R1576:Muc6 UTSW 7 141,214,437 (GRCm39) missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141,234,265 (GRCm39) missense probably damaging 1.00
R1702:Muc6 UTSW 7 141,236,752 (GRCm39) missense probably damaging 1.00
R1792:Muc6 UTSW 7 141,214,371 (GRCm39) missense probably benign 0.41
R1924:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R1938:Muc6 UTSW 7 141,217,011 (GRCm39) missense probably damaging 0.99
R1964:Muc6 UTSW 7 141,226,330 (GRCm39) intron probably benign
R1964:Muc6 UTSW 7 141,226,329 (GRCm39) nonsense probably null
R1975:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R2031:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141,213,991 (GRCm39) missense probably benign 0.23
R2201:Muc6 UTSW 7 141,236,075 (GRCm39) missense probably damaging 1.00
R2218:Muc6 UTSW 7 141,233,227 (GRCm39) missense probably benign 0.41
R2245:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2271:Muc6 UTSW 7 141,217,423 (GRCm39) missense possibly damaging 0.53
R2272:Muc6 UTSW 7 141,217,423 (GRCm39) missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141,217,837 (GRCm39) missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141,217,444 (GRCm39) missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141,226,651 (GRCm39) missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141,216,951 (GRCm39) missense possibly damaging 0.86
R3406:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3423:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141,234,946 (GRCm39) splice site probably benign
R3872:Muc6 UTSW 7 141,226,867 (GRCm39) missense probably benign
R4029:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141,234,920 (GRCm39) missense probably damaging 1.00
R4126:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141,217,576 (GRCm39) missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141,226,356 (GRCm39) intron probably benign
R4509:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141,230,489 (GRCm39) missense probably benign 0.03
R4594:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141,224,212 (GRCm39) intron probably benign
R4678:Muc6 UTSW 7 141,230,554 (GRCm39) missense probably benign 0.09
R4737:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R4737:Muc6 UTSW 7 141,226,426 (GRCm39) intron probably benign
R4981:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5012:Muc6 UTSW 7 141,216,570 (GRCm39) missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141,226,795 (GRCm39) missense probably benign
R5058:Muc6 UTSW 7 141,230,491 (GRCm39) missense probably benign 0.01
R5069:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5126:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5168:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5179:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141,237,375 (GRCm39) missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141,217,836 (GRCm39) missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141,235,078 (GRCm39) missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141,216,448 (GRCm39) missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141,235,850 (GRCm39) critical splice donor site probably null
R5800:Muc6 UTSW 7 141,226,690 (GRCm39) splice site probably benign
R5808:Muc6 UTSW 7 141,226,360 (GRCm39) intron probably benign
R5865:Muc6 UTSW 7 141,236,769 (GRCm39) missense probably damaging 0.97
R5919:Muc6 UTSW 7 141,227,837 (GRCm39) missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141,234,640 (GRCm39) missense probably damaging 1.00
R6126:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141,226,792 (GRCm39) missense probably benign
R6236:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6245:Muc6 UTSW 7 141,235,086 (GRCm39) missense probably damaging 1.00
R6254:Muc6 UTSW 7 141,237,380 (GRCm39) missense probably benign 0.09
R6418:Muc6 UTSW 7 141,224,032 (GRCm39) intron probably benign
R6609:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6610:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6611:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6623:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6626:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6817:Muc6 UTSW 7 141,237,326 (GRCm39) missense probably damaging 0.99
R6923:Muc6 UTSW 7 141,217,453 (GRCm39) missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141,226,246 (GRCm39) intron probably benign
R7001:Muc6 UTSW 7 141,217,320 (GRCm39) missense probably damaging 0.99
R7046:Muc6 UTSW 7 141,226,456 (GRCm39) intron probably benign
R7097:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7099:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7101:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7107:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7108:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7112:Muc6 UTSW 7 141,235,542 (GRCm39) missense probably damaging 1.00
R7202:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7204:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7205:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7222:Muc6 UTSW 7 141,214,428 (GRCm39) missense unknown
R7230:Muc6 UTSW 7 141,235,479 (GRCm39) missense probably damaging 1.00
R7278:Muc6 UTSW 7 141,226,842 (GRCm39) missense probably benign 0.09
R7483:Muc6 UTSW 7 141,224,245 (GRCm39) missense unknown
R7501:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7601:Muc6 UTSW 7 141,216,454 (GRCm39) missense unknown
R7641:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7644:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7645:Muc6 UTSW 7 141,234,923 (GRCm39) missense probably benign 0.40
R7659:Muc6 UTSW 7 141,216,973 (GRCm39) missense possibly damaging 0.53
R7674:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7679:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7680:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7689:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7690:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7760:Muc6 UTSW 7 141,237,322 (GRCm39) splice site probably null
R7806:Muc6 UTSW 7 141,217,387 (GRCm39) missense possibly damaging 0.53
R7809:Muc6 UTSW 7 141,226,638 (GRCm39) missense probably benign 0.02
R7848:Muc6 UTSW 7 141,232,188 (GRCm39) missense possibly damaging 0.53
R7859:Muc6 UTSW 7 141,231,687 (GRCm39) missense probably damaging 0.96
R8054:Muc6 UTSW 7 141,231,748 (GRCm39) missense probably damaging 1.00
R8085:Muc6 UTSW 7 141,226,729 (GRCm39) missense unknown
R8130:Muc6 UTSW 7 141,233,354 (GRCm39) missense probably damaging 0.97
R8210:Muc6 UTSW 7 141,235,673 (GRCm39) critical splice donor site probably null
R8273:Muc6 UTSW 7 141,226,795 (GRCm39) missense unknown
R8294:Muc6 UTSW 7 141,217,263 (GRCm39) missense possibly damaging 0.96
R8329:Muc6 UTSW 7 141,226,525 (GRCm39) missense unknown
R8379:Muc6 UTSW 7 141,230,579 (GRCm39) nonsense probably null
R8537:Muc6 UTSW 7 141,234,184 (GRCm39) missense probably benign 0.03
R8736:Muc6 UTSW 7 141,228,439 (GRCm39) missense possibly damaging 0.53
R8767:Muc6 UTSW 7 141,229,549 (GRCm39) missense probably damaging 1.00
R8902:Muc6 UTSW 7 141,233,791 (GRCm39) missense possibly damaging 0.93
R9009:Muc6 UTSW 7 141,217,018 (GRCm39) missense possibly damaging 0.73
R9010:Muc6 UTSW 7 141,226,351 (GRCm39) missense unknown
R9023:Muc6 UTSW 7 141,237,432 (GRCm39) nonsense probably null
R9058:Muc6 UTSW 7 141,218,154 (GRCm39) missense possibly damaging 0.61
R9257:Muc6 UTSW 7 141,226,738 (GRCm39) missense unknown
R9495:Muc6 UTSW 7 141,237,398 (GRCm39) missense probably damaging 0.98
R9563:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9645:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9659:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
R9733:Muc6 UTSW 7 141,216,310 (GRCm39) missense unknown
R9787:Muc6 UTSW 7 141,227,748 (GRCm39) nonsense probably null
R9788:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
V7581:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
V7583:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
X0026:Muc6 UTSW 7 141,237,964 (GRCm39) missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
Z1177:Muc6 UTSW 7 141,237,656 (GRCm39) missense probably benign 0.20
Z1177:Muc6 UTSW 7 141,236,701 (GRCm39) missense probably benign 0.29
Z1177:Muc6 UTSW 7 141,217,827 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCCTGTCACATTACTTACCAGG -3'
(R):5'- TCCAACTGCTGCCTCAACTG -3'

Sequencing Primer
(F):5'- GTCACATTACTTACCAGGATGCGAG -3'
(R):5'- TCGAGTAGGCCAACCTCCAG -3'
Posted On 2016-06-06