Incidental Mutation 'R7690:Muc6'
ID593338
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Namemucin 6, gastric
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7690 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141633456-141655319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 141637746 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 2338 (P2338R)
Ref Sequence ENSEMBL: ENSMUSP00000140483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
Predicted Effect probably benign
Transcript: ENSMUST00000003038
SMART Domains Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 590 1.7e-147 PFAM
low complexity region 646 659 N/A INTRINSIC
low complexity region 661 684 N/A INTRINSIC
Alpha_adaptinC2 706 819 1.45e-26 SMART
Pfam:Alpha_adaptin_C 825 933 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062451
AA Change: P2273R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: P2273R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190907
AA Change: P2338R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: P2338R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,314,154 T710S probably benign Het
Adgrl2 A G 3: 148,817,298 L430P Het
Agap1 T C 1: 89,843,071 S648P probably benign Het
Alox5 T C 6: 116,415,456 H368R probably damaging Het
Ano2 T C 6: 126,013,198 F761L probably damaging Het
Aox4 T C 1: 58,263,917 V1169A probably damaging Het
Apbb1ip T A 2: 22,816,984 M11K unknown Het
Arl5a G T 2: 52,412,065 H112Q possibly damaging Het
Ccdc18 C T 5: 108,228,662 T1323I probably benign Het
Cmtm5 G A 14: 54,936,481 probably benign Het
Cul2 T C 18: 3,419,420 Y194H probably benign Het
Daglb T C 5: 143,494,183 I415T possibly damaging Het
Ddx28 A G 8: 106,010,331 V365A probably damaging Het
Dnah6 T C 6: 73,169,080 probably null Het
Eppk1 T A 15: 76,111,746 T312S probably benign Het
Erich4 C A 7: 25,615,285 V68L possibly damaging Het
Fam171a2 G A 11: 102,437,834 P700S probably benign Het
Fat3 T C 9: 15,998,181 N2175S probably damaging Het
Fcrl6 T G 1: 172,598,656 R191S probably damaging Het
Fpgt A G 3: 155,087,830 S187P probably damaging Het
Gapvd1 T G 2: 34,729,122 T80P possibly damaging Het
Gclm A G 3: 122,246,056 N24S probably damaging Het
Gdf15 A G 8: 70,631,347 I89T possibly damaging Het
Gpn2 A G 4: 133,591,382 E306G probably damaging Het
Iars2 A T 1: 185,320,997 L359Q probably damaging Het
Kbtbd4 T G 2: 90,905,896 C84G possibly damaging Het
Manea A G 4: 26,327,910 V377A probably benign Het
Map4 C T 9: 109,999,793 T82I probably damaging Het
Mocos C T 18: 24,664,025 H81Y probably damaging Het
Mtx1 T A 3: 89,212,781 T87S Het
Myom2 A T 8: 15,111,717 probably null Het
Mzt1 C T 14: 99,040,588 C48Y probably damaging Het
Nlrp9b C A 7: 20,024,370 P511T probably benign Het
Noc2l A G 4: 156,237,631 E135G probably benign Het
Nova1 G A 12: 46,720,766 P124L unknown Het
Pax8 T A 2: 24,441,670 T134S probably benign Het
Pde4a T A 9: 21,166,004 L26Q probably damaging Het
Pde6b G A 5: 108,419,518 E254K probably damaging Het
Pdlim7 A G 13: 55,508,931 I70T probably damaging Het
Pinx1 T A 14: 63,864,211 probably null Het
Pomt2 C A 12: 87,130,367 R352L probably damaging Het
Rapgef5 G A 12: 117,721,370 V519I possibly damaging Het
Rnps1 A G 17: 24,418,194 E16G unknown Het
Slc4a5 T C 6: 83,285,872 F782S probably damaging Het
Snap91 A G 9: 86,824,978 V253A possibly damaging Het
Syce3 T C 15: 89,397,341 M32V possibly damaging Het
Tcaf3 C A 6: 42,597,135 V48L probably damaging Het
Tenm4 T C 7: 96,863,533 V1366A probably benign Het
Tnxb G A 17: 34,689,520 M1382I probably benign Het
Tnxb G A 17: 34,689,527 G1385R probably damaging Het
Top3a G T 11: 60,756,380 L238I probably damaging Het
Trim9 A T 12: 70,248,343 N742K probably benign Het
Trp63 T A 16: 25,876,733 Y482N unknown Het
Ttc23 T G 7: 67,670,170 F192V possibly damaging Het
Uck1 A G 2: 32,258,172 V180A probably benign Het
Vwa5b1 G A 4: 138,590,933 T541I probably damaging Het
Zfp456 G T 13: 67,366,794 H264Q probably damaging Het
Zfpm2 T G 15: 40,954,766 V165G possibly damaging Het
Zufsp C T 10: 33,930,155 probably null Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141638584 missense probably benign 0.06
IGL00466:Muc6 APN 7 141645902 missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141638890 missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141648066 nonsense probably null
IGL01021:Muc6 APN 7 141637162 missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141648454 missense probably damaging 1.00
IGL01294:Muc6 APN 7 141646659 missense probably damaging 1.00
IGL01449:Muc6 APN 7 141638614 missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141651307 missense probably damaging 1.00
IGL01539:Muc6 APN 7 141650041 missense probably benign 0.07
IGL01541:Muc6 APN 7 141649804 nonsense probably null
IGL01810:Muc6 APN 7 141651062 missense probably damaging 0.97
IGL01941:Muc6 APN 7 141638584 missense probably benign 0.06
IGL01954:Muc6 APN 7 141638584 missense probably benign 0.06
IGL02096:Muc6 APN 7 141639850 intron probably benign
IGL02192:Muc6 APN 7 141637804 missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141649624 missense probably damaging 1.00
IGL02234:Muc6 APN 7 141640575 missense probably benign 0.09
IGL02302:Muc6 APN 7 141641496 missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141640459 missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141636940 missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141649578 splice site probably benign
IGL02851:Muc6 APN 7 141648361 missense probably damaging 1.00
IGL03026:Muc6 APN 7 141640147 intron probably benign
IGL03070:Muc6 APN 7 141644567 splice site probably benign
IGL03108:Muc6 APN 7 141637489 missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141652059 missense probably damaging 1.00
IGL03366:Muc6 APN 7 141648082 missense probably damaging 1.00
F5770:Muc6 UTSW 7 141647613 missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R0153:Muc6 UTSW 7 141634116 missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141639559 intron probably benign
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141636955 missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141652283 missense probably benign 0.01
R0499:Muc6 UTSW 7 141640468 missense probably benign
R0503:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141638584 missense probably benign 0.06
R0792:Muc6 UTSW 7 141639559 intron probably benign
R0880:Muc6 UTSW 7 141637357 missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141644233 missense probably damaging 0.99
R1174:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1175:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1189:Muc6 UTSW 7 141645855 missense probably damaging 1.00
R1259:Muc6 UTSW 7 141640197 intron probably benign
R1293:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R1295:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1296:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1471:Muc6 UTSW 7 141647909 missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1548:Muc6 UTSW 7 141652103 splice site probably benign
R1548:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1576:Muc6 UTSW 7 141634524 missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141647998 missense probably damaging 1.00
R1702:Muc6 UTSW 7 141650487 missense probably damaging 1.00
R1792:Muc6 UTSW 7 141634458 missense probably benign 0.41
R1924:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R1938:Muc6 UTSW 7 141637098 missense probably damaging 0.99
R1964:Muc6 UTSW 7 141640062 nonsense probably null
R1964:Muc6 UTSW 7 141640063 intron probably benign
R1975:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R2031:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141634078 missense probably benign 0.23
R2201:Muc6 UTSW 7 141649810 missense probably damaging 1.00
R2218:Muc6 UTSW 7 141646960 missense probably benign 0.41
R2245:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2271:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2272:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141637924 missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141637531 missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141640384 missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141637038 missense possibly damaging 0.86
R3406:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3423:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141648681 splice site probably benign
R3872:Muc6 UTSW 7 141640600 missense probably benign
R4029:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141648655 missense probably damaging 1.00
R4126:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141637663 missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141640089 intron probably benign
R4509:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141644222 missense probably benign 0.03
R4594:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141639790 intron probably benign
R4678:Muc6 UTSW 7 141644287 missense probably benign 0.09
R4737:Muc6 UTSW 7 141640159 intron probably benign
R4737:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4981:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141639559 intron probably benign
R5012:Muc6 UTSW 7 141636657 missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141640528 missense probably benign
R5027:Muc6 UTSW 7 141636436 missense probably benign 0.01
R5058:Muc6 UTSW 7 141644224 missense probably benign 0.01
R5069:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5126:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5168:Muc6 UTSW 7 141639559 intron probably benign
R5179:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141651110 missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141637923 missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141648813 missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141636535 missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141649585 critical splice donor site probably null
R5800:Muc6 UTSW 7 141640423 splice site probably benign
R5808:Muc6 UTSW 7 141640093 intron probably benign
R5865:Muc6 UTSW 7 141650504 missense probably damaging 0.97
R5919:Muc6 UTSW 7 141641570 missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141648374 missense probably damaging 1.00
R6126:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141640525 missense probably benign
R6236:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6245:Muc6 UTSW 7 141648821 missense probably damaging 1.00
R6254:Muc6 UTSW 7 141651115 missense probably benign 0.09
R6418:Muc6 UTSW 7 141639610 intron probably benign
R6609:Muc6 UTSW 7 141640433 splice site probably benign
R6610:Muc6 UTSW 7 141640433 splice site probably benign
R6611:Muc6 UTSW 7 141640433 splice site probably benign
R6623:Muc6 UTSW 7 141639559 intron probably benign
R6626:Muc6 UTSW 7 141639559 intron probably benign
R6817:Muc6 UTSW 7 141651061 missense probably damaging 0.99
R6923:Muc6 UTSW 7 141637540 missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141639979 intron probably benign
R7001:Muc6 UTSW 7 141637407 missense probably damaging 0.99
R7046:Muc6 UTSW 7 141640189 intron probably benign
R7097:Muc6 UTSW 7 141634450 frame shift probably null
R7099:Muc6 UTSW 7 141634450 frame shift probably null
R7101:Muc6 UTSW 7 141634450 frame shift probably null
R7107:Muc6 UTSW 7 141634450 frame shift probably null
R7108:Muc6 UTSW 7 141634450 frame shift probably null
R7112:Muc6 UTSW 7 141649277 missense probably damaging 1.00
R7202:Muc6 UTSW 7 141634450 frame shift probably null
R7204:Muc6 UTSW 7 141634450 frame shift probably null
R7205:Muc6 UTSW 7 141634450 frame shift probably null
R7222:Muc6 UTSW 7 141634515 missense unknown
R7230:Muc6 UTSW 7 141649214 missense probably damaging 1.00
R7278:Muc6 UTSW 7 141640575 missense probably benign 0.09
R7483:Muc6 UTSW 7 141639823 missense unknown
R7501:Muc6 UTSW 7 141637746 missense probably damaging 0.98
R7601:Muc6 UTSW 7 141636541 missense unknown
R7641:Muc6 UTSW 7 141639825 missense unknown
R7644:Muc6 UTSW 7 141637746 missense probably damaging 0.98
R7645:Muc6 UTSW 7 141648658 missense probably benign 0.40
R7659:Muc6 UTSW 7 141637060 missense possibly damaging 0.53
R7674:Muc6 UTSW 7 141639825 missense unknown
R7679:Muc6 UTSW 7 141637746 missense probably damaging 0.98
R7680:Muc6 UTSW 7 141637746 missense probably damaging 0.98
R7689:Muc6 UTSW 7 141637746 missense probably damaging 0.98
R7760:Muc6 UTSW 7 141651057 splice site probably null
R7806:Muc6 UTSW 7 141637474 missense possibly damaging 0.53
R7809:Muc6 UTSW 7 141640371 missense probably benign 0.02
R7848:Muc6 UTSW 7 141645921 missense possibly damaging 0.53
R7859:Muc6 UTSW 7 141645420 missense probably damaging 0.96
R8054:Muc6 UTSW 7 141645481 missense probably damaging 1.00
R8085:Muc6 UTSW 7 141640462 missense unknown
R8130:Muc6 UTSW 7 141647087 missense probably damaging 0.97
R8210:Muc6 UTSW 7 141649408 critical splice donor site probably null
R8273:Muc6 UTSW 7 141640528 missense unknown
R8294:Muc6 UTSW 7 141637350 missense possibly damaging 0.96
R8329:Muc6 UTSW 7 141640258 missense unknown
R8379:Muc6 UTSW 7 141644312 nonsense probably null
V7581:Muc6 UTSW 7 141647613 missense probably benign 0.11
V7583:Muc6 UTSW 7 141647613 missense probably benign 0.11
X0026:Muc6 UTSW 7 141651699 missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
Z1177:Muc6 UTSW 7 141637914 missense possibly damaging 0.72
Z1177:Muc6 UTSW 7 141650436 missense probably benign 0.29
Z1177:Muc6 UTSW 7 141651391 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AATGGTGGCAGTGATGTGAC -3'
(R):5'- ATGACTGTCCTTCCAACCAC -3'

Sequencing Primer
(F):5'- CAGTGATGTGACTAAAGAGGTCTG -3'
(R):5'- TGTCACATATACAACCACTGCTG -3'
Posted On2019-11-12