Mutagenetix > Incidental Mutation

Incidental Mutation 'R7806:Muc6'

600778

Institutional Source

Beutler Lab

Gene Symbol

Muc6

Ensembl Gene

ENSMUSG00000048191

Gene Name

mucin 6, gastric

Synonyms

MMRRC Submission

045861-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R7806 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141213373-141241641 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 141217387 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2429 (T2429A)

Ref Sequence

ENSEMBL: ENSMUSP00000140483 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000003038

SMART Domains

Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	29	590	1.7e-147	PFAM
low complexity region	646	659	N/A	INTRINSIC
low complexity region	661	684	N/A	INTRINSIC
Alpha_adaptinC2	706	819	1.45e-26	SMART
Pfam:Alpha_adaptin_C	825	933	2.8e-47	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062451
AA Change: T2364A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: T2364A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	2.49e-14	SMART
C8	267	340	5.46e-3	SMART
Pfam:TIL	344	399	5.6e-14	PFAM
VWC	401	469	2.57e-7	SMART
VWD	428	591	4.81e-30	SMART
C8	627	703	8.84e-21	SMART
SCOP:d1coua_	706	769	7e-9	SMART
Pfam:TIL	806	869	1.9e-9	PFAM
VWC	871	941	8.52e-3	SMART
VWD	898	1060	1.59e-30	SMART
C8	1096	1170	5.52e-31	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
internal_repeat_3	1375	1560	6.78e-17	PROSPERO
internal_repeat_2	1426	1751	8.94e-34	PROSPERO
low complexity region	1761	1780	N/A	INTRINSIC
low complexity region	1867	1887	N/A	INTRINSIC
low complexity region	1896	1910	N/A	INTRINSIC
low complexity region	1912	1946	N/A	INTRINSIC
low complexity region	1990	2004	N/A	INTRINSIC
low complexity region	2010	2020	N/A	INTRINSIC
internal_repeat_2	2036	2430	8.94e-34	PROSPERO
internal_repeat_3	2329	2516	6.78e-17	PROSPERO
low complexity region	2519	2536	N/A	INTRINSIC
low complexity region	2564	2587	N/A	INTRINSIC
low complexity region	2605	2630	N/A	INTRINSIC
low complexity region	2642	2677	N/A	INTRINSIC
low complexity region	2729	2762	N/A	INTRINSIC
Blast:CT	2765	2852	1e-44	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000189314

SMART Domains

Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	193	2.64e-27	SMART
C8	226	299	5.46e-3	SMART
Pfam:TIL	303	358	1.4e-13	PFAM
VWC	360	428	2.57e-7	SMART
VWD	387	550	4.81e-30	SMART
C8	586	662	8.84e-21	SMART
internal_repeat_2	665	754	5.76e-7	PROSPERO
Pfam:TIL	765	828	6.4e-9	PFAM
VWC	830	900	8.52e-3	SMART
VWD	857	1019	1.59e-30	SMART
C8	1055	1129	5.52e-31	SMART
low complexity region	1199	1228	N/A	INTRINSIC
low complexity region	1234	1252	N/A	INTRINSIC
low complexity region	1272	1296	N/A	INTRINSIC
low complexity region	1304	1333	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190907
AA Change: T2429A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: T2429A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	1.2e-16	SMART
C8	267	340	4.2e-7	SMART
Pfam:TIL	344	399	7.2e-11	PFAM
VWC_def	401	469	1.2e-9	SMART
VWD	428	591	2.4e-32	SMART
C8	627	703	6.7e-25	SMART
SCOP:d1coua_	706	769	5e-9	SMART
Pfam:TIL	806	869	3.3e-6	PFAM
VWC_def	871	941	4.1e-5	SMART
VWD	898	1060	7.7e-33	SMART
C8	1096	1170	4.2e-35	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
low complexity region	1406	1419	N/A	INTRINSIC
internal_repeat_1	1426	1822	3.44e-48	PROSPERO
low complexity region	1826	1845	N/A	INTRINSIC
low complexity region	1932	1952	N/A	INTRINSIC
low complexity region	1961	1975	N/A	INTRINSIC
low complexity region	1977	2011	N/A	INTRINSIC
low complexity region	2055	2069	N/A	INTRINSIC
low complexity region	2075	2085	N/A	INTRINSIC
internal_repeat_1	2101	2501	3.44e-48	PROSPERO
low complexity region	2504	2524	N/A	INTRINSIC
low complexity region	2584	2601	N/A	INTRINSIC
low complexity region	2629	2652	N/A	INTRINSIC
low complexity region	2670	2695	N/A	INTRINSIC
low complexity region	2707	2742	N/A	INTRINSIC
low complexity region	2794	2827	N/A	INTRINSIC
Blast:CT	2830	2917	1e-44	BLAST

Meta Mutation Damage Score

0.1275

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (83/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	C	A	8: 125,569,143 (GRCm39)	V144F	probably benign	Het
Aar2	T	A	2: 156,393,031 (GRCm39)	I140N	possibly damaging	Het
Abca15	A	G	7: 119,932,059 (GRCm39)	N104S	probably damaging	Het
Adam22	A	T	5: 8,142,825 (GRCm39)	N803K	probably damaging	Het
Adk	A	G	14: 21,376,679 (GRCm39)	N26S		Het
Ak9	A	C	10: 41,309,080 (GRCm39)		probably null	Het
Alpk2	T	C	18: 65,482,487 (GRCm39)	D40G	probably benign	Het
Ankrd65	A	T	4: 155,877,437 (GRCm39)	H316L	probably benign	Het
Cabp7	C	T	11: 4,688,889 (GRCm39)	A194T	probably damaging	Het
Ccdc180	A	C	4: 45,912,801 (GRCm39)	K593N	possibly damaging	Het
Cd80	A	G	16: 38,294,315 (GRCm39)	D66G	probably benign	Het
Cdh5	T	C	8: 104,867,448 (GRCm39)	V575A	probably damaging	Het
Cep350	T	C	1: 155,737,809 (GRCm39)	Q2678R	probably benign	Het
Cideb	G	A	14: 55,992,625 (GRCm39)	T97M	probably damaging	Het
Clca4b	T	C	3: 144,638,157 (GRCm39)	D35G	probably benign	Het
Clpx	T	C	9: 65,207,213 (GRCm39)	V37A	probably benign	Het
Cmya5	A	C	13: 93,230,770 (GRCm39)	S1439R	probably benign	Het
Cndp2	T	A	18: 84,688,945 (GRCm39)	H279L	probably benign	Het
Cngb1	A	T	8: 96,025,432 (GRCm39)		probably null	Het
Cpq	T	A	15: 33,497,443 (GRCm39)	N394K	possibly damaging	Het
Dedd	T	C	1: 171,166,062 (GRCm39)	L60P	probably benign	Het
Dennd3	C	A	15: 73,442,624 (GRCm39)	L1216M	possibly damaging	Het
Dntt	A	T	19: 41,018,071 (GRCm39)	N65I	probably benign	Het
Fap	T	A	2: 62,333,758 (GRCm39)	E662V	probably damaging	Het
Fasn	A	T	11: 120,700,821 (GRCm39)	M2066K	probably benign	Het
Fggy	G	A	4: 95,489,203 (GRCm39)	G69E	probably benign	Het
Foxc1	G	T	13: 31,992,739 (GRCm39)	G517C	unknown	Het
Gas2l3	A	G	10: 89,249,232 (GRCm39)	Y629H	probably benign	Het
Gcnt2	A	G	13: 41,071,717 (GRCm39)	N120S	probably damaging	Het
Gfpt2	A	G	11: 49,714,142 (GRCm39)	T300A	probably benign	Het
Glud1	A	G	14: 34,065,606 (GRCm39)	R535G	probably damaging	Het
Gm3248	T	A	14: 5,943,883 (GRCm38)	I114L	probably benign	Het
Gm3278	G	A	14: 16,082,211 (GRCm39)		probably null	Het
Gm3402	A	C	5: 146,451,090 (GRCm39)	K44Q	probably damaging	Het
Gm3696	C	G	14: 18,433,094 (GRCm39)	R188S	probably benign	Het
Gm3696	C	A	14: 18,433,095 (GRCm39)	R188M	probably benign	Het
Gmppa	T	C	1: 75,415,581 (GRCm39)	L113P	probably damaging	Het
Gmps	A	G	3: 63,890,091 (GRCm39)		probably null	Het
Gnal	T	A	18: 67,346,145 (GRCm39)	M275K	probably damaging	Het
Gopc	G	C	10: 52,229,525 (GRCm39)	N231K	probably damaging	Het
Gpr152	T	C	19: 4,193,487 (GRCm39)	S343P	probably benign	Het
Gpr17	T	C	18: 32,080,593 (GRCm39)	I157V	probably benign	Het
Grm7	T	A	6: 111,223,314 (GRCm39)	Y451*	probably null	Het
Ikbke	T	C	1: 131,199,635 (GRCm39)	E286G	probably damaging	Het
Inpp5b	A	T	4: 124,678,881 (GRCm39)		probably null	Het
Iqgap2	G	A	13: 95,818,765 (GRCm39)	L664F	probably benign	Het
Kif17	A	G	4: 138,015,507 (GRCm39)	E552G	possibly damaging	Het
Lamtor1	T	A	7: 101,555,220 (GRCm39)	Y5*	probably null	Het
Lpin2	A	G	17: 71,552,166 (GRCm39)	I829V	probably damaging	Het
Lrg1	T	G	17: 56,426,967 (GRCm39)	D335A	probably benign	Het
Lrriq3	T	C	3: 154,804,444 (GRCm39)	Y35H	probably damaging	Het
Mkx	T	A	18: 7,000,607 (GRCm39)	M112L	probably benign	Het
Mlxipl	A	C	5: 135,163,397 (GRCm39)	D760A	possibly damaging	Het
N4bp2l2	A	G	5: 150,566,715 (GRCm39)	C134R	unknown	Het
Nanos1	A	G	19: 60,744,972 (GRCm39)	E90G	probably benign	Het
Nckap1	T	C	2: 80,371,843 (GRCm39)	D329G	probably damaging	Het
Or13a18	T	C	7: 140,190,685 (GRCm39)	I194T	probably benign	Het
Or14j9	A	C	17: 37,875,112 (GRCm39)	L30R	probably damaging	Het
Or8b12c	T	C	9: 37,715,872 (GRCm39)	S222P	probably damaging	Het
Or8g51	G	T	9: 38,609,567 (GRCm39)	L32I	probably benign	Het
Osbpl7	A	G	11: 96,946,954 (GRCm39)	H419R	probably benign	Het
Otog	C	T	7: 45,935,200 (GRCm39)	T1395I	probably benign	Het
Pigq	T	A	17: 26,150,700 (GRCm39)	I451F	probably benign	Het
Ptgfrn	A	G	3: 100,984,448 (GRCm39)	V248A	possibly damaging	Het
Rdh19	G	T	10: 127,692,740 (GRCm39)	V136L	probably damaging	Het
Rfesd	T	C	13: 76,156,308 (GRCm39)	T33A	possibly damaging	Het
Rnf213	G	A	11: 119,302,371 (GRCm39)	V432M		Het
Rpl22l1	T	A	3: 28,860,962 (GRCm39)	L60Q	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,229,127 (GRCm39)		probably benign	Het
Samd3	A	G	10: 26,120,425 (GRCm39)	T140A	probably benign	Het
Sbf1	A	G	15: 89,189,623 (GRCm39)	V419A	possibly damaging	Het
Serpinb6a	T	C	13: 34,119,548 (GRCm39)		probably null	Het
Slc22a4	A	G	11: 53,881,476 (GRCm39)	L414P	probably damaging	Het
Smarcd3	A	T	5: 24,798,260 (GRCm39)	V420D	probably benign	Het
Tcaim	A	G	9: 122,663,995 (GRCm39)	D495G	probably damaging	Het
Tep1	A	G	14: 51,074,266 (GRCm39)	V1873A	possibly damaging	Het
Tmcc2	T	C	1: 132,288,527 (GRCm39)	N387D	probably damaging	Het
Tmed8	A	T	12: 87,219,204 (GRCm39)	I322N	probably damaging	Het
Tmod4	A	C	3: 95,034,915 (GRCm39)	D168A	probably benign	Het
Trgc2	A	T	13: 19,491,390 (GRCm39)		probably benign	Het
Trp53bp1	C	T	2: 121,035,542 (GRCm39)	E1520K	probably damaging	Het
Trpv5	T	A	6: 41,651,867 (GRCm39)	I183F	probably damaging	Het
Vmn2r70	A	T	7: 85,208,401 (GRCm39)	I692K	probably benign	Het
Vmn2r87	T	A	10: 130,315,679 (GRCm39)	Y129F	probably benign	Het
Vps8	A	G	16: 21,278,501 (GRCm39)	D253G	probably damaging	Het
Ythdc2	T	C	18: 44,977,353 (GRCm39)	I383T	possibly damaging	Het
Ythdc2	T	C	18: 44,983,491 (GRCm39)	S553P	probably benign	Het
Zfyve26	A	G	12: 79,327,129 (GRCm39)		probably null	Het
Zic1	G	A	9: 91,247,024 (GRCm39)	T16I	probably damaging	Het

Other mutations in Muc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL00466:Muc6	APN	7	141,232,169 (GRCm39)	missense	possibly damaging	0.94
IGL00990:Muc6	APN	7	141,638,890 (GRCm38)	missense	possibly damaging	0.85
IGL01013:Muc6	APN	7	141,234,333 (GRCm39)	nonsense	probably null
IGL01021:Muc6	APN	7	141,217,075 (GRCm39)	missense	possibly damaging	0.53
IGL01061:Muc6	APN	7	141,234,720 (GRCm39)	missense	probably damaging	1.00
IGL01294:Muc6	APN	7	141,232,926 (GRCm39)	missense	probably damaging	1.00
IGL01449:Muc6	APN	7	141,218,527 (GRCm39)	missense	possibly damaging	0.92
IGL01474:Muc6	APN	7	141,237,572 (GRCm39)	missense	probably damaging	1.00
IGL01539:Muc6	APN	7	141,236,306 (GRCm39)	missense	probably benign	0.07
IGL01541:Muc6	APN	7	141,236,069 (GRCm39)	nonsense	probably null
IGL01810:Muc6	APN	7	141,237,327 (GRCm39)	missense	probably damaging	0.97
IGL01941:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL01954:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL02096:Muc6	APN	7	141,226,117 (GRCm39)	intron	probably benign
IGL02192:Muc6	APN	7	141,217,717 (GRCm39)	missense	possibly damaging	0.91
IGL02217:Muc6	APN	7	141,235,889 (GRCm39)	missense	probably damaging	1.00
IGL02234:Muc6	APN	7	141,226,842 (GRCm39)	missense	probably benign	0.09
IGL02302:Muc6	APN	7	141,227,763 (GRCm39)	missense	possibly damaging	0.53
IGL02331:Muc6	APN	7	141,226,726 (GRCm39)	missense	possibly damaging	0.53
IGL02531:Muc6	APN	7	141,216,853 (GRCm39)	missense	possibly damaging	0.53
IGL02639:Muc6	APN	7	141,235,843 (GRCm39)	splice site	probably benign
IGL02851:Muc6	APN	7	141,234,627 (GRCm39)	missense	probably damaging	1.00
IGL03026:Muc6	APN	7	141,226,414 (GRCm39)	intron	probably benign
IGL03070:Muc6	APN	7	141,230,834 (GRCm39)	splice site	probably benign
IGL03108:Muc6	APN	7	141,217,402 (GRCm39)	missense	possibly damaging	0.93
IGL03350:Muc6	APN	7	141,238,324 (GRCm39)	missense	probably damaging	1.00
IGL03366:Muc6	APN	7	141,234,349 (GRCm39)	missense	probably damaging	1.00
anticipation	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
F5770:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
IGL03147:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0001:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R0005:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0147:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R0153:Muc6	UTSW	7	141,214,029 (GRCm39)	missense	possibly damaging	0.68
R0227:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0304:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0379:Muc6	UTSW	7	141,216,868 (GRCm39)	missense	possibly damaging	0.53
R0385:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0423:Muc6	UTSW	7	141,238,548 (GRCm39)	missense	probably benign	0.01
R0499:Muc6	UTSW	7	141,226,735 (GRCm39)	missense	probably benign
R0503:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0757:Muc6	UTSW	7	141,218,497 (GRCm39)	missense	probably benign	0.06
R0792:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0880:Muc6	UTSW	7	141,217,270 (GRCm39)	missense	possibly damaging	0.91
R1136:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1170:Muc6	UTSW	7	141,230,500 (GRCm39)	missense	probably damaging	0.99
R1174:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1175:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1189:Muc6	UTSW	7	141,232,122 (GRCm39)	missense	probably damaging	1.00
R1259:Muc6	UTSW	7	141,226,464 (GRCm39)	intron	probably benign
R1293:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R1295:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1296:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1471:Muc6	UTSW	7	141,234,176 (GRCm39)	missense	possibly damaging	0.61
R1472:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1548:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1548:Muc6	UTSW	7	141,238,368 (GRCm39)	splice site	probably benign
R1576:Muc6	UTSW	7	141,214,437 (GRCm39)	missense	possibly damaging	0.92
R1689:Muc6	UTSW	7	141,234,265 (GRCm39)	missense	probably damaging	1.00
R1702:Muc6	UTSW	7	141,236,752 (GRCm39)	missense	probably damaging	1.00
R1792:Muc6	UTSW	7	141,214,371 (GRCm39)	missense	probably benign	0.41
R1924:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R1938:Muc6	UTSW	7	141,217,011 (GRCm39)	missense	probably damaging	0.99
R1964:Muc6	UTSW	7	141,226,330 (GRCm39)	intron	probably benign
R1964:Muc6	UTSW	7	141,226,329 (GRCm39)	nonsense	probably null
R1975:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R2031:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2104:Muc6	UTSW	7	141,213,991 (GRCm39)	missense	probably benign	0.23
R2201:Muc6	UTSW	7	141,236,075 (GRCm39)	missense	probably damaging	1.00
R2218:Muc6	UTSW	7	141,233,227 (GRCm39)	missense	probably benign	0.41
R2245:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2261:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2271:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2272:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2284:Muc6	UTSW	7	141,217,837 (GRCm39)	missense	possibly damaging	0.53
R2310:Muc6	UTSW	7	141,217,444 (GRCm39)	missense	possibly damaging	0.53
R2566:Muc6	UTSW	7	141,226,651 (GRCm39)	missense	possibly damaging	0.73
R2975:Muc6	UTSW	7	141,216,951 (GRCm39)	missense	possibly damaging	0.86
R3406:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3423:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3548:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3693:Muc6	UTSW	7	141,234,946 (GRCm39)	splice site	probably benign
R3872:Muc6	UTSW	7	141,226,867 (GRCm39)	missense	probably benign
R4029:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4084:Muc6	UTSW	7	141,234,920 (GRCm39)	missense	probably damaging	1.00
R4126:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4410:Muc6	UTSW	7	141,217,576 (GRCm39)	missense	possibly damaging	0.91
R4508:Muc6	UTSW	7	141,226,356 (GRCm39)	intron	probably benign
R4509:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4518:Muc6	UTSW	7	141,230,489 (GRCm39)	missense	probably benign	0.03
R4594:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4677:Muc6	UTSW	7	141,224,212 (GRCm39)	intron	probably benign
R4678:Muc6	UTSW	7	141,230,554 (GRCm39)	missense	probably benign	0.09
R4737:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4737:Muc6	UTSW	7	141,226,426 (GRCm39)	intron	probably benign
R4981:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R5008:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5012:Muc6	UTSW	7	141,216,570 (GRCm39)	missense	possibly damaging	0.96
R5017:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	probably benign
R5027:Muc6	UTSW	7	141,216,349 (GRCm39)	missense	probably benign	0.01
R5058:Muc6	UTSW	7	141,230,491 (GRCm39)	missense	probably benign	0.01
R5069:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5126:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5168:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5179:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5198:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5262:Muc6	UTSW	7	141,237,375 (GRCm39)	missense	possibly damaging	0.78
R5381:Muc6	UTSW	7	141,217,836 (GRCm39)	missense	possibly damaging	0.86
R5454:Muc6	UTSW	7	141,235,078 (GRCm39)	missense	possibly damaging	0.61
R5467:Muc6	UTSW	7	141,216,448 (GRCm39)	missense	possibly damaging	0.53
R5540:Muc6	UTSW	7	141,235,850 (GRCm39)	critical splice donor site	probably null
R5800:Muc6	UTSW	7	141,226,690 (GRCm39)	splice site	probably benign
R5808:Muc6	UTSW	7	141,226,360 (GRCm39)	intron	probably benign
R5865:Muc6	UTSW	7	141,236,769 (GRCm39)	missense	probably damaging	0.97
R5919:Muc6	UTSW	7	141,227,837 (GRCm39)	missense	possibly damaging	0.56
R6024:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R6064:Muc6	UTSW	7	141,234,640 (GRCm39)	missense	probably damaging	1.00
R6126:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6229:Muc6	UTSW	7	141,226,792 (GRCm39)	missense	probably benign
R6236:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6245:Muc6	UTSW	7	141,235,086 (GRCm39)	missense	probably damaging	1.00
R6254:Muc6	UTSW	7	141,237,380 (GRCm39)	missense	probably benign	0.09
R6418:Muc6	UTSW	7	141,224,032 (GRCm39)	intron	probably benign
R6609:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6610:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6611:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6623:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6626:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6817:Muc6	UTSW	7	141,237,326 (GRCm39)	missense	probably damaging	0.99
R6923:Muc6	UTSW	7	141,217,453 (GRCm39)	missense	possibly damaging	0.91
R6989:Muc6	UTSW	7	141,226,246 (GRCm39)	intron	probably benign
R7001:Muc6	UTSW	7	141,217,320 (GRCm39)	missense	probably damaging	0.99
R7046:Muc6	UTSW	7	141,226,456 (GRCm39)	intron	probably benign
R7097:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7099:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7101:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7107:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7108:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7112:Muc6	UTSW	7	141,235,542 (GRCm39)	missense	probably damaging	1.00
R7202:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7204:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7205:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7222:Muc6	UTSW	7	141,214,428 (GRCm39)	missense	unknown
R7230:Muc6	UTSW	7	141,235,479 (GRCm39)	missense	probably damaging	1.00
R7278:Muc6	UTSW	7	141,226,842 (GRCm39)	missense	probably benign	0.09
R7483:Muc6	UTSW	7	141,224,245 (GRCm39)	missense	unknown
R7501:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7601:Muc6	UTSW	7	141,216,454 (GRCm39)	missense	unknown
R7641:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7644:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7645:Muc6	UTSW	7	141,234,923 (GRCm39)	missense	probably benign	0.40
R7659:Muc6	UTSW	7	141,216,973 (GRCm39)	missense	possibly damaging	0.53
R7674:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7679:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7680:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7689:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7690:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7760:Muc6	UTSW	7	141,237,322 (GRCm39)	splice site	probably null
R7809:Muc6	UTSW	7	141,226,638 (GRCm39)	missense	probably benign	0.02
R7848:Muc6	UTSW	7	141,232,188 (GRCm39)	missense	possibly damaging	0.53
R7859:Muc6	UTSW	7	141,231,687 (GRCm39)	missense	probably damaging	0.96
R8054:Muc6	UTSW	7	141,231,748 (GRCm39)	missense	probably damaging	1.00
R8085:Muc6	UTSW	7	141,226,729 (GRCm39)	missense	unknown
R8130:Muc6	UTSW	7	141,233,354 (GRCm39)	missense	probably damaging	0.97
R8210:Muc6	UTSW	7	141,235,673 (GRCm39)	critical splice donor site	probably null
R8273:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	unknown
R8294:Muc6	UTSW	7	141,217,263 (GRCm39)	missense	possibly damaging	0.96
R8329:Muc6	UTSW	7	141,226,525 (GRCm39)	missense	unknown
R8379:Muc6	UTSW	7	141,230,579 (GRCm39)	nonsense	probably null
R8537:Muc6	UTSW	7	141,234,184 (GRCm39)	missense	probably benign	0.03
R8736:Muc6	UTSW	7	141,228,439 (GRCm39)	missense	possibly damaging	0.53
R8767:Muc6	UTSW	7	141,229,549 (GRCm39)	missense	probably damaging	1.00
R8902:Muc6	UTSW	7	141,233,791 (GRCm39)	missense	possibly damaging	0.93
R9009:Muc6	UTSW	7	141,217,018 (GRCm39)	missense	possibly damaging	0.73
R9010:Muc6	UTSW	7	141,226,351 (GRCm39)	missense	unknown
R9023:Muc6	UTSW	7	141,237,432 (GRCm39)	nonsense	probably null
R9058:Muc6	UTSW	7	141,218,154 (GRCm39)	missense	possibly damaging	0.61
R9257:Muc6	UTSW	7	141,226,738 (GRCm39)	missense	unknown
R9495:Muc6	UTSW	7	141,237,398 (GRCm39)	missense	probably damaging	0.98
R9563:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9645:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9659:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
R9733:Muc6	UTSW	7	141,216,310 (GRCm39)	missense	unknown
R9787:Muc6	UTSW	7	141,227,748 (GRCm39)	nonsense	probably null
R9788:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
V7581:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
V7583:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
X0026:Muc6	UTSW	7	141,237,964 (GRCm39)	missense	possibly damaging	0.94
X0058:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
Z1177:Muc6	UTSW	7	141,237,656 (GRCm39)	missense	probably benign	0.20
Z1177:Muc6	UTSW	7	141,236,701 (GRCm39)	missense	probably benign	0.29
Z1177:Muc6	UTSW	7	141,217,827 (GRCm39)	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- ACTGCTAGTTGTGCCTGAGG -3'
(R):5'- GAACATCTGAGCAGTCCACC -3'

Sequencing Primer
(F):5'- TGGAGTACCAGTTACACCCATGG -3'
(R):5'- TCTGAGCAGTCCACCACCAC -3'

Posted On

2019-11-26