Incidental Mutation 'R5118:Mrap2'
ID392747
Institutional Source Beutler Lab
Gene Symbol Mrap2
Ensembl Gene ENSMUSG00000042761
Gene Namemelanocortin 2 receptor accessory protein 2
Synonyms
MMRRC Submission 042706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5118 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location87144306-87184045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87182703 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 166 (F166L)
Ref Sequence ENSEMBL: ENSMUSP00000135904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049457] [ENSMUST00000113149] [ENSMUST00000179313]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049457
AA Change: F166L

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046271
Gene: ENSMUSG00000042761
AA Change: F166L

DomainStartEndE-ValueType
Pfam:MRAP 14 102 6.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113149
AA Change: F166L

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108774
Gene: ENSMUSG00000042761
AA Change: F166L

DomainStartEndE-ValueType
Pfam:MRAP 14 102 6.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179313
AA Change: F166L

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135904
Gene: ENSMUSG00000042761
AA Change: F166L

DomainStartEndE-ValueType
Pfam:MRAP 15 101 4.5e-38 PFAM
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that modulates melanocortin receptor signaling. The encoded protein has been shown to interact with all known melanocortin receptors and may regulate both receptor trafficking and activation in response to ligands. Mice lacking a functional copy of this gene exhibit severe obesity and a mutation in this gene may be associated with severe obesity in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe obesity at a young age. Obesity develops early during ad libitum feeding before the onset of hyperphagia, persists in mutant mice pair-fed to a normal dietary intake, and is abolished only by underfeeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adamts2 A G 11: 50,781,869 E648G probably damaging Het
Ankrd55 A G 13: 112,355,939 S187G probably benign Het
BC080695 T C 4: 143,571,127 L39P probably damaging Het
C87414 T A 5: 93,637,797 D208V probably benign Het
Cd44 C A 2: 102,865,370 E52D probably damaging Het
Col6a5 T A 9: 105,937,005 I603F unknown Het
Dmxl2 C A 9: 54,460,987 R233L probably damaging Het
Dopey1 T C 9: 86,506,259 F429L probably damaging Het
Epsti1 T G 14: 77,986,682 probably null Het
Erfe G T 1: 91,370,716 probably null Het
Galnt5 A G 2: 58,015,003 D526G probably damaging Het
Gm1330 T C 2: 149,002,986 probably benign Het
Gm6181 G A 7: 52,755,616 noncoding transcript Het
Irak2 T A 6: 113,665,811 V68D probably benign Het
Kdm1a A G 4: 136,557,358 probably benign Het
Kidins220 C A 12: 24,992,297 Q198K probably damaging Het
Lgr5 A G 10: 115,452,339 V728A possibly damaging Het
Micall2 G A 5: 139,716,447 T347M probably damaging Het
Msh3 A T 13: 92,309,434 probably benign Het
Mul1 T A 4: 138,439,349 L238Q probably damaging Het
Nuak1 G T 10: 84,374,984 H413Q probably benign Het
Olfr1408 T C 1: 173,130,917 Q100R possibly damaging Het
Pcnt C T 10: 76,412,168 A931T probably damaging Het
Pddc1 A T 7: 141,406,806 probably benign Het
Psmb4 T C 3: 94,884,942 Y223C probably damaging Het
Rbm15b G T 9: 106,886,102 A289E possibly damaging Het
Reg3b T A 6: 78,372,128 V79E probably damaging Het
Rsl1 A G 13: 67,181,981 I164M probably damaging Het
Rtp1 T C 16: 23,431,535 F217L probably benign Het
Sfmbt1 T C 14: 30,790,770 L360P probably damaging Het
Sorbs2 T C 8: 45,795,785 V611A probably damaging Het
Tenm4 T A 7: 96,893,086 D1935E probably damaging Het
Tep1 T C 14: 50,855,587 probably null Het
Tmppe T G 9: 114,405,481 S283A probably benign Het
Tmtc1 A G 6: 148,269,987 probably benign Het
Trp63 T C 16: 25,889,010 I552T unknown Het
Tspan2 C A 3: 102,749,835 D45E probably benign Het
Ubr1 T C 2: 120,882,264 E1396G probably benign Het
Usp17lc A T 7: 103,418,661 T388S probably benign Het
Wdr46 T C 17: 33,948,837 V508A possibly damaging Het
Zcchc11 T A 4: 108,520,292 D966E possibly damaging Het
Zfp462 T A 4: 55,010,667 Y878N probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp954 T A 7: 7,115,715 T277S probably benign Het
Other mutations in Mrap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0790:Mrap2 UTSW 9 87182782 missense possibly damaging 0.74
R4598:Mrap2 UTSW 9 87182789 missense probably damaging 1.00
R5949:Mrap2 UTSW 9 87182605 missense probably benign 0.02
R6144:Mrap2 UTSW 9 87175818 missense probably damaging 1.00
R6925:Mrap2 UTSW 9 87182474 missense possibly damaging 0.52
R8312:Mrap2 UTSW 9 87169659 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTTTGTGTCAGACTTCGG -3'
(R):5'- CTTGCTGTACAGAGACAGAACAC -3'

Sequencing Primer
(F):5'- CAGACAAGGTGTTTTCTCGTCAG -3'
(R):5'- CATCCTCAGTAAGGCACAAGTGTC -3'
Posted On2016-06-15