Mutagenetix > Incidental Mutations

Incidental Mutation 'R5120:Dhh'

392963

Institutional Source

Beutler Lab

Gene Symbol

Dhh

Ensembl Gene

ENSMUSG00000023000

Gene Name

desert hedgehog

Synonyms

MMRRC Submission

042708-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.612) question?

Stock #

R5120 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98891152-98898540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98898157 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 39 (Q39R)

Ref Sequence

ENSEMBL: ENSMUSP00000155712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023737] [ENSMUST00000229508] [ENSMUST00000229556] [ENSMUST00000229775]

Predicted Effect

probably benign
Transcript: ENSMUST00000023737
AA Change: Q39R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000023737
Gene: ENSMUSG00000023000
AA Change: Q39R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:HH_signal	23	185	2.1e-86	PFAM
Pfam:Peptidase_M15_3	129	185	5.9e-8	PFAM
HintN	197	304	1.29e-25	SMART
HintC	305	349	1.89e-9	SMART
low complexity region	358	374	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229352

Predicted Effect

probably benign
Transcript: ENSMUST00000229508

Predicted Effect

probably benign
Transcript: ENSMUST00000229556

Predicted Effect

probably benign
Transcript: ENSMUST00000229775
AA Change: Q39R

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230242

Meta Mutation Damage Score

0.1934

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.6%

Validation Efficiency

100% (97/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog family. The hedgehog gene family encodes signaling molecules that play an important role in regulating morphogenesis. This protein is predicted to be made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the organism. Defects in this protein have been associated with partial gonadal dysgenesis (PGD) accompanied by minifascicular polyneuropathy. This protein may be involved in both male gonadal differentiation and perineurial development. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mutants are male sterile, failing to produce mature spermatozoa; peripheral nerves are abnormal, with thin and disorganized perineurial sheaths. High penetrance of pseudohermaphroditism observed on some mixed backgrounds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,210,235	H225R	probably benign	Het
Abcc9	T	A	6: 142,656,618	I690F	probably benign	Het
Acp4	A	T	7: 44,256,971	D52E	probably damaging	Het
Adam17	T	C	12: 21,343,019		probably benign	Het
Adamts15	T	C	9: 30,921,576	E221G	probably damaging	Het
Aoc2	A	G	11: 101,325,714	T208A	probably benign	Het
Apoa4	T	G	9: 46,242,737	I212S	probably damaging	Het
Bptf	A	T	11: 107,073,385	M1598K	probably damaging	Het
Camsap3	G	A	8: 3,600,680	R209Q	probably damaging	Het
Ccdc171	C	A	4: 83,558,526		probably benign	Het
Celsr2	G	C	3: 108,393,120	P2875A	probably benign	Het
Cenpb	A	G	2: 131,179,818	V20A	probably benign	Het
Cfap61	A	T	2: 146,143,160	K975*	probably null	Het
Col9a2	G	T	4: 121,039,772	A20S	unknown	Het
Crnn	A	T	3: 93,148,896	I330F	probably benign	Het
Csf3r	C	A	4: 126,035,827	P381Q	probably benign	Het
Csmd3	G	A	15: 48,673,495	Q104*	probably null	Het
Ctnna1	G	A	18: 35,182,554		probably null	Het
Cwf19l2	C	T	9: 3,418,761	Q183*	probably null	Het
Ddx60	T	C	8: 61,945,906	Y220H	probably benign	Het
Dynlrb2	T	A	8: 116,515,698	I89N	possibly damaging	Het
Dytn	T	C	1: 63,623,043	E645G	probably benign	Het
Efcab7	A	G	4: 99,897,491	T287A	probably damaging	Het
Eogt	A	G	6: 97,134,315	V195A	probably benign	Het
Ep400	G	T	5: 110,756,358	P125Q	probably damaging	Het
Fasn	A	G	11: 120,811,391	V1815A	probably benign	Het
Gm4788	T	C	1: 139,753,103	S226G	probably benign	Het
Gm5866	T	C	5: 52,582,882		noncoding transcript	Het
Gm8674	C	A	13: 49,901,948		noncoding transcript	Het
Gpat4	G	T	8: 23,180,202	H270Q	possibly damaging	Het
Grik5	A	G	7: 25,010,640	L890P	probably damaging	Het
Gsap	A	G	5: 21,269,936	N500S	probably damaging	Het
H2-M10.1	T	C	17: 36,325,156	D173G	probably benign	Het
Igfn1	T	A	1: 135,973,502	I413F	possibly damaging	Het
Ighv1-52	G	T	12: 115,145,786	H17N	probably benign	Het
Kcnu1	T	A	8: 25,934,488	D270E	possibly damaging	Het
Kif16b	A	C	2: 142,848,339	N274K	probably damaging	Het
Klk1b11	C	T	7: 43,999,022	T151I	probably benign	Het
Krtap13	A	G	16: 88,751,570	F10S	probably damaging	Het
Large1	A	T	8: 72,859,341	I379N	probably damaging	Het
Lhx8	T	C	3: 154,311,695	H301R	probably damaging	Het
Lrriq3	T	C	3: 155,129,384	V252A	probably benign	Het
Lysmd3	T	A	13: 81,669,192	I96N	probably damaging	Het
Mpeg1	C	T	19: 12,461,429	Q84*	probably null	Het
Myoz1	C	T	14: 20,650,654	G165D	probably benign	Het
Myt1	G	A	2: 181,797,620	V312I	probably benign	Het
Ndufb7	T	C	8: 83,566,977		probably benign	Het
Numa1	C	T	7: 101,977,437	T10M	probably damaging	Het
Olfr1285	T	C	2: 111,409,240		noncoding transcript	Het
Olfr130	A	T	17: 38,067,266	I32F	probably damaging	Het
Olfr1316	A	T	2: 112,130,558	D84E	probably damaging	Het
Olfr149	T	A	9: 39,702,070	H233L	probably benign	Het
Olfr390	A	C	11: 73,786,964	I9L	probably benign	Het
Osmr	A	T	15: 6,827,275	S464T	probably benign	Het
Pak7	G	A	2: 136,083,229	H718Y	probably damaging	Het
Pan2	T	A	10: 128,314,995		probably null	Het
Pik3r4	T	C	9: 105,669,009	S853P	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Polr3gl	T	A	3: 96,578,479		probably benign	Het
Psd2	G	A	18: 35,979,810	R186Q	possibly damaging	Het
Psd4	T	C	2: 24,405,438	V868A	probably benign	Het
Ralgapa2	G	T	2: 146,412,084	T852K	probably benign	Het
Rbm43	T	C	2: 51,932,423		probably benign	Het
Rps6kl1	C	A	12: 85,139,348	G329C	probably damaging	Het
Scaf11	T	C	15: 96,419,542	T714A	probably benign	Het
Selenoo	C	A	15: 89,094,305	N310K	possibly damaging	Het
Sepsecs	T	C	5: 52,660,661	Q258R	probably damaging	Het
Sgcz	T	C	8: 37,526,266	S226G	probably benign	Het
Slfn5	A	G	11: 82,960,928	K627E	probably damaging	Het
Sos1	A	T	17: 80,408,248	F1027I	probably damaging	Het
Ssh1	C	G	5: 113,957,398	V228L	possibly damaging	Het
Sugp1	C	A	8: 70,048,667	P65T	probably benign	Het
Tas2r106	T	A	6: 131,678,816	N24I	probably damaging	Het
Tex10	T	C	4: 48,459,272	E534G	possibly damaging	Het
Tmem182	C	T	1: 40,854,901	T192I	possibly damaging	Het
Traf7	T	A	17: 24,518,744	K51*	probably null	Het
Trap1	C	A	16: 4,044,088	R604L	probably damaging	Het
Trim6	T	A	7: 104,228,240	L179Q	probably damaging	Het
Ubfd1	T	C	7: 122,071,750	S264P	probably damaging	Het
Upk3bl	T	C	5: 136,064,191		probably benign	Het
Wdfy3	T	A	5: 101,868,106	Q2601L	possibly damaging	Het
Wdr89	A	G	12: 75,632,638	Y281H	probably damaging	Het
Zfp286	A	T	11: 62,780,725	M174K	probably benign	Het
Zmym1	T	C	4: 127,051,437		probably null	Het

Other mutations in Dhh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00900:Dhh	APN	15	98898220	unclassified	probably benign
IGL01845:Dhh	APN	15	98897983	missense	probably damaging	1.00
IGL02728:Dhh	APN	15	98894311	unclassified	probably null
R0096:Dhh	UTSW	15	98893988	missense	probably benign	0.00
R1294:Dhh	UTSW	15	98894383	missense	probably benign	0.00
R1842:Dhh	UTSW	15	98894560	unclassified	probably null
R4351:Dhh	UTSW	15	98898218	unclassified	probably benign
R4727:Dhh	UTSW	15	98898142	missense	probably damaging	0.99
R4744:Dhh	UTSW	15	98894258	missense	possibly damaging	0.86
R6419:Dhh	UTSW	15	98894401	missense	probably damaging	1.00
R6630:Dhh	UTSW	15	98894366	missense	possibly damaging	0.86
R7031:Dhh	UTSW	15	98894026	missense	possibly damaging	0.84
R7032:Dhh	UTSW	15	98894026	missense	possibly damaging	0.84
R7330:Dhh	UTSW	15	98894410	missense	probably damaging	1.00
X0060:Dhh	UTSW	15	98894309	missense	possibly damaging	0.95
Z1088:Dhh	UTSW	15	98894909	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGTTCATCCTCCAGGGTTGTTG -3'
(R):5'- TGCCCAATTGACAGGAGAGC -3'

Sequencing Primer
(F):5'- TACCTCTGTCATCAGGCGG -3'
(R):5'- CCAGTGAGGACAAGAACGCTC -3'

Posted On

2016-06-15