Incidental Mutation 'R4744:Dhh'
ID397278
Institutional Source Beutler Lab
Gene Symbol Dhh
Ensembl Gene ENSMUSG00000023000
Gene Namedesert hedgehog
Synonyms
MMRRC Submission 042027-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R4744 (G1)
Quality Score71
Status Validated
Chromosome15
Chromosomal Location98891152-98898540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98894258 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 290 (F290L)
Ref Sequence ENSEMBL: ENSMUSP00000023737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023737] [ENSMUST00000229508] [ENSMUST00000229556] [ENSMUST00000229775]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023737
AA Change: F290L

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023737
Gene: ENSMUSG00000023000
AA Change: F290L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HH_signal 23 185 2.1e-86 PFAM
Pfam:Peptidase_M15_3 129 185 5.9e-8 PFAM
HintN 197 304 1.29e-25 SMART
HintC 305 349 1.89e-9 SMART
low complexity region 358 374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229352
Predicted Effect probably benign
Transcript: ENSMUST00000229508
Predicted Effect probably benign
Transcript: ENSMUST00000229556
Predicted Effect probably benign
Transcript: ENSMUST00000229775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230242
Meta Mutation Damage Score 0.8317 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog family. The hedgehog gene family encodes signaling molecules that play an important role in regulating morphogenesis. This protein is predicted to be made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the organism. Defects in this protein have been associated with partial gonadal dysgenesis (PGD) accompanied by minifascicular polyneuropathy. This protein may be involved in both male gonadal differentiation and perineurial development. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mutants are male sterile, failing to produce mature spermatozoa; peripheral nerves are abnormal, with thin and disorganized perineurial sheaths. High penetrance of pseudohermaphroditism observed on some mixed backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,879,556 S143P possibly damaging Het
4933427D14Rik T C 11: 72,175,539 K614E probably damaging Het
Aatk A G 11: 120,016,122 M155T possibly damaging Het
Acvr2b T C 9: 119,431,262 L333P probably damaging Het
Adam22 T C 5: 8,078,699 E865G probably damaging Het
Add2 A G 6: 86,110,888 S358G probably damaging Het
Agap2 T C 10: 127,090,203 probably null Het
Alkbh8 G A 9: 3,344,604 W49* probably null Het
AU015228 A T 2: 130,100,629 noncoding transcript Het
Bank1 G T 3: 136,247,689 R102S probably benign Het
Brap T A 5: 121,662,130 D27E probably damaging Het
Cyb5r2 G T 7: 107,750,277 H276N possibly damaging Het
Dhrs7 T A 12: 72,652,251 N319I possibly damaging Het
Ebpl A G 14: 61,360,233 V53A probably damaging Het
Eif3j2 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC 18: 43,477,717 probably benign Het
Etnk1 A C 6: 143,186,593 N220T probably damaging Het
F11r T A 1: 171,460,598 V64D probably benign Het
Fam171a1 T C 2: 3,224,909 S360P probably damaging Het
Fignl1 A G 11: 11,801,585 M490T probably damaging Het
Fpr-rs7 A T 17: 20,114,003 M75K probably benign Het
Fzd7 T A 1: 59,484,436 F493I possibly damaging Het
Galnt14 G T 17: 73,507,833 P412T probably damaging Het
Gcg T A 2: 62,478,631 S60C probably damaging Het
Ggt1 A G 10: 75,585,899 K527E probably benign Het
Gm14085 A T 2: 122,522,805 K489* probably null Het
Gm16551 T A 9: 74,850,871 noncoding transcript Het
Gm9972 A G 11: 43,036,690 K55E unknown Het
Gpr141 T A 13: 19,751,714 D297V probably benign Het
Grin2b G A 6: 135,778,699 S539L probably damaging Het
Hhipl1 A T 12: 108,319,979 N515I possibly damaging Het
Hmcn1 T G 1: 150,577,612 E5317D probably damaging Het
Hsf5 T A 11: 87,622,791 N227K probably benign Het
Igfn1 A T 1: 135,982,458 D129E probably benign Het
Invs T C 4: 48,397,609 F339L probably damaging Het
Jak2 T A 19: 29,262,256 S17T probably benign Het
Mdga2 T A 12: 66,797,727 I166F probably benign Het
Nck1 T C 9: 100,506,744 I6V probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nmur2 A G 11: 56,040,835 Y17H probably benign Het
Nwd2 T C 5: 63,806,967 L1298P probably damaging Het
Ocel1 A G 8: 71,372,753 E161G probably damaging Het
Olfr345 A T 2: 36,640,979 probably null Het
Pabpc2 A G 18: 39,774,828 Y382C probably benign Het
Panx1 A G 9: 15,010,298 probably benign Het
Pdhx A T 2: 103,042,296 V147D probably benign Het
Pigz A T 16: 31,945,333 H403L probably damaging Het
Pilra T C 5: 137,835,507 probably null Het
Rbm47 T C 5: 66,026,693 D189G probably damaging Het
Rhobtb2 A G 14: 69,794,002 L558P probably damaging Het
Scarf2 G A 16: 17,803,516 R322H probably damaging Het
Sept3 T C 15: 82,290,457 probably null Het
Sirt2 T C 7: 28,777,013 F26L probably damaging Het
Slc1a1 A T 19: 28,894,525 T133S probably benign Het
Slc1a2 A G 2: 102,737,869 I84V probably benign Het
Slc6a9 A T 4: 117,867,895 Q562L probably benign Het
Snx29 C T 16: 11,349,909 Q25* probably null Het
St6galnac6 A G 2: 32,618,543 I231V probably damaging Het
Stard9 A G 2: 120,696,123 T954A probably benign Het
Sufu A G 19: 46,483,630 M443V possibly damaging Het
Sv2b T C 7: 75,206,518 D8G probably benign Het
Tapbpl G A 6: 125,228,285 R233W probably damaging Het
Tex10 A G 4: 48,469,990 L25S probably benign Het
Trp53bp1 A T 2: 121,211,313 V1254D probably damaging Het
Ugt3a1 T A 15: 9,310,553 I307N probably benign Het
Unc13c T C 9: 73,931,844 D575G probably damaging Het
Usf2 A T 7: 30,954,772 D166E probably damaging Het
Usp25 T A 16: 77,114,989 L969M probably damaging Het
Usp32 G A 11: 84,994,393 P1276L probably damaging Het
Vmn2r8 T A 5: 108,808,581 E58D probably benign Het
Zfp462 G T 4: 55,011,598 C40F probably damaging Het
Other mutations in Dhh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Dhh APN 15 98898220 unclassified probably benign
IGL01845:Dhh APN 15 98897983 missense probably damaging 1.00
IGL02728:Dhh APN 15 98894311 unclassified probably null
R0096:Dhh UTSW 15 98893988 missense probably benign 0.00
R1294:Dhh UTSW 15 98894383 missense probably benign 0.00
R1842:Dhh UTSW 15 98894560 unclassified probably null
R4351:Dhh UTSW 15 98898218 unclassified probably benign
R4727:Dhh UTSW 15 98898142 missense probably damaging 0.99
R5120:Dhh UTSW 15 98898157 missense probably benign 0.05
R6419:Dhh UTSW 15 98894401 missense probably damaging 1.00
R6630:Dhh UTSW 15 98894366 missense possibly damaging 0.86
R7031:Dhh UTSW 15 98894026 missense possibly damaging 0.84
R7032:Dhh UTSW 15 98894026 missense possibly damaging 0.84
R7330:Dhh UTSW 15 98894410 missense probably damaging 1.00
X0060:Dhh UTSW 15 98894309 missense possibly damaging 0.95
Z1088:Dhh UTSW 15 98894909 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACTGGTGACTCTCTAGAAC -3'
(R):5'- TACATCGTGGTGACTGGGTAC -3'

Sequencing Primer
(F):5'- TGACTCTCTAGAACCGCGTAG -3'
(R):5'- TACTGGCCGCTGATGCAG -3'
Posted On2016-07-05