Incidental Mutation 'R5173:Dpp4'
ID398865
Institutional Source Beutler Lab
Gene Symbol Dpp4
Ensembl Gene ENSMUSG00000035000
Gene Namedipeptidylpeptidase 4
SynonymsDpp-4, THAM, Cd26
MMRRC Submission 042753-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5173 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62330073-62412231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62387130 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 41 (Y41C)
Ref Sequence ENSEMBL: ENSMUSP00000044050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047812]
Predicted Effect probably damaging
Transcript: ENSMUST00000047812
AA Change: Y41C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044050
Gene: ENSMUSG00000035000
AA Change: Y41C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 102 473 5.7e-110 PFAM
Pfam:Abhydrolase_5 545 752 1e-11 PFAM
Pfam:DLH 546 754 4e-7 PFAM
Pfam:Peptidase_S9 551 760 3.4e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149306
Meta Mutation Damage Score 0.5086 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic membrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show hypoglycemia, hyperinsulinemia, and increased plasma glucagon-like peptide 1 in glucose tolerance tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,100,567 R54* probably null Het
Abca13 AC A 11: 9,682,032 probably null Het
Abca6 A T 11: 110,191,720 F1142L probably benign Het
Ap1g1 T A 8: 109,851,132 probably null Het
Apob T C 12: 8,008,238 V2207A probably benign Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Chd3 A G 11: 69,369,243 probably benign Het
Coch C A 12: 51,596,507 Y103* probably null Het
Cul3 A T 1: 80,281,416 D382E possibly damaging Het
Cul5 T C 9: 53,642,734 T291A probably benign Het
Dab1 T C 4: 104,688,448 probably null Het
Dmtf1 A G 5: 9,140,356 probably benign Het
Eif2ak4 A G 2: 118,408,360 I45M probably damaging Het
Epn3 T C 11: 94,496,097 K149R probably damaging Het
Flnc A G 6: 29,455,538 E2029G probably damaging Het
Gm5799 A G 14: 43,544,659 N96S probably damaging Het
Gm9573 G T 17: 35,620,741 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grik5 T C 7: 25,062,894 H224R possibly damaging Het
Lpar6 A T 14: 73,239,097 E166V probably benign Het
Mical1 T C 10: 41,484,989 L683P probably damaging Het
Mis18bp1 T C 12: 65,149,375 I538M possibly damaging Het
Mobp A G 9: 120,168,245 R77G possibly damaging Het
Mylk A G 16: 34,977,013 H1614R probably benign Het
Olfr1179 G A 2: 88,402,922 T4I probably benign Het
Olfr1388 T C 11: 49,443,886 F12L probably benign Het
Olfr371 T C 8: 85,230,576 L27P probably damaging Het
Osbpl1a C T 18: 12,762,640 V390I probably benign Het
Pcdha7 C A 18: 36,974,652 D243E probably benign Het
Pi4ka A T 16: 17,350,906 N653K possibly damaging Het
Plin5 T G 17: 56,115,548 probably null Het
Plod1 A G 4: 147,916,301 probably benign Het
Psd3 T C 8: 67,696,989 K372E probably damaging Het
Psmd11 C T 11: 80,460,740 T263I probably benign Het
Ptprt A T 2: 161,927,756 N396K probably benign Het
Rab39 T C 9: 53,686,500 E155G probably damaging Het
Rimbp2 T C 5: 128,797,648 D293G probably benign Het
Rnf220 T C 4: 117,289,274 probably benign Het
Rnmt C T 18: 68,321,359 probably benign Het
Slc10a1 T A 12: 80,956,028 I279F probably damaging Het
Taar6 A G 10: 23,985,352 Y99H probably damaging Het
Tas2r144 T A 6: 42,216,114 F263I probably benign Het
Tex15 T A 8: 33,571,740 N399K possibly damaging Het
Tlr9 T A 9: 106,225,952 V814D possibly damaging Het
Tmem53 T A 4: 117,265,711 probably benign Het
Ubap2l T C 3: 90,021,030 I511V possibly damaging Het
Vmn2r60 T C 7: 42,195,511 M766T probably damaging Het
Zfp462 T C 4: 55,011,115 V1027A probably damaging Het
Other mutations in Dpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dpp4 APN 2 62379302 missense probably damaging 1.00
IGL02205:Dpp4 APN 2 62352257 missense probably damaging 1.00
IGL02276:Dpp4 APN 2 62356951 splice site probably benign
IGL02335:Dpp4 APN 2 62334644 missense probably benign 0.03
IGL02615:Dpp4 APN 2 62359328 missense probably damaging 1.00
IGL02639:Dpp4 APN 2 62352240 missense probably benign
IGL02972:Dpp4 APN 2 62352225 missense probably damaging 1.00
IGL03366:Dpp4 APN 2 62356957 splice site probably null
caribou UTSW 2 62347901 missense possibly damaging 0.69
PIT4449001:Dpp4 UTSW 2 62356644 missense probably benign 0.00
R0502:Dpp4 UTSW 2 62364988 missense probably damaging 0.99
R0581:Dpp4 UTSW 2 62356676 missense probably benign
R1004:Dpp4 UTSW 2 62332640 missense probably benign 0.08
R1075:Dpp4 UTSW 2 62352286 missense probably benign 0.39
R1476:Dpp4 UTSW 2 62347901 missense possibly damaging 0.69
R1702:Dpp4 UTSW 2 62386429 critical splice donor site probably null
R1707:Dpp4 UTSW 2 62359335 splice site probably benign
R1733:Dpp4 UTSW 2 62372869 critical splice acceptor site probably null
R1899:Dpp4 UTSW 2 62345050 splice site probably benign
R2264:Dpp4 UTSW 2 62378239 missense possibly damaging 0.71
R2496:Dpp4 UTSW 2 62387133 missense possibly damaging 0.90
R3765:Dpp4 UTSW 2 62386436 missense probably benign 0.17
R4278:Dpp4 UTSW 2 62379323 missense probably damaging 1.00
R4413:Dpp4 UTSW 2 62387140 missense possibly damaging 0.89
R4432:Dpp4 UTSW 2 62345112 missense probably damaging 1.00
R4647:Dpp4 UTSW 2 62334605 missense probably damaging 1.00
R4710:Dpp4 UTSW 2 62360315 missense probably benign 0.04
R4914:Dpp4 UTSW 2 62347892 missense probably benign 0.20
R5283:Dpp4 UTSW 2 62360336 missense probably damaging 1.00
R5698:Dpp4 UTSW 2 62334311 missense probably damaging 1.00
R6621:Dpp4 UTSW 2 62352140 missense probably damaging 1.00
R6681:Dpp4 UTSW 2 62348549 missense probably benign 0.01
R6739:Dpp4 UTSW 2 62387095 missense probably benign
R6962:Dpp4 UTSW 2 62372830 missense probably benign 0.11
R7249:Dpp4 UTSW 2 62385203 missense probably benign 0.14
R7268:Dpp4 UTSW 2 62347842 missense probably damaging 1.00
R7343:Dpp4 UTSW 2 62358901 nonsense probably null
R7357:Dpp4 UTSW 2 62387077 missense probably benign
R7366:Dpp4 UTSW 2 62354599 missense probably damaging 1.00
R7413:Dpp4 UTSW 2 62356989 missense probably damaging 1.00
R7431:Dpp4 UTSW 2 62352238 missense probably benign 0.01
R7642:Dpp4 UTSW 2 62360283 critical splice donor site probably null
R8004:Dpp4 UTSW 2 62358828 missense probably benign 0.00
R8197:Dpp4 UTSW 2 62372827 missense probably benign 0.31
R8341:Dpp4 UTSW 2 62347890 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCTCCCTTTTGTACTTCTAAGCAAG -3'
(R):5'- TTCAAGGAATTCTTACTCCACTGAC -3'

Sequencing Primer
(F):5'- AATACTGCACAGAGTTTCAAAGG -3'
(R):5'- GGAATTCTTACTCCACTGACTAAAC -3'
Posted On2016-07-06