Incidental Mutation 'R5178:Exo5'
ID399452
Institutional Source Beutler Lab
Gene Symbol Exo5
Ensembl Gene ENSMUSG00000028629
Gene Nameexonuclease 5
Synonyms
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location120921196-120925017 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 120921537 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030375] [ENSMUST00000144114] [ENSMUST00000156836] [ENSMUST00000177880]
Predicted Effect probably benign
Transcript: ENSMUST00000030375
SMART Domains Protein: ENSMUSP00000030375
Gene: ENSMUSG00000028629

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Exo5 71 355 1.3e-82 PFAM
Pfam:PDDEXK_1 92 353 2.4e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144114
SMART Domains Protein: ENSMUSP00000116454
Gene: ENSMUSG00000028629

DomainStartEndE-ValueType
Pfam:Exo5 1 141 2.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156836
SMART Domains Protein: ENSMUSP00000118041
Gene: ENSMUSG00000028629

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Exo5 71 133 1.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177880
SMART Domains Protein: ENSMUSP00000136408
Gene: ENSMUSG00000028629

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Exo5 71 196 1.1e-30 PFAM
Pfam:PDDEXK_1 94 353 6.5e-7 PFAM
Pfam:Exo5 190 355 1.5e-28 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-stranded DNA (ssDNA)-specific exonuclease that can slide along the DNA before cutting it. However, human replication protein A binds ssDNA and restricts sliding of the encoded protein, providing a 5'-directionality to the enzyme. This protein localizes to nuclear repair loci after DNA damage. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Exo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02932:Exo5 APN 4 120922545 missense probably benign 0.01
IGL03063:Exo5 APN 4 120921633 missense possibly damaging 0.60
R0417:Exo5 UTSW 4 120922072 missense probably damaging 1.00
R0540:Exo5 UTSW 4 120921981 missense probably damaging 0.99
R0609:Exo5 UTSW 4 120921684 missense probably damaging 1.00
R1126:Exo5 UTSW 4 120922125 missense probably damaging 1.00
R2401:Exo5 UTSW 4 120921997 missense probably damaging 0.97
R4658:Exo5 UTSW 4 120922551 missense probably benign
R5093:Exo5 UTSW 4 120922317 missense probably damaging 1.00
R5125:Exo5 UTSW 4 120921537 critical splice donor site probably null
R6492:Exo5 UTSW 4 120921537 utr 3 prime probably benign
R6736:Exo5 UTSW 4 120921756 missense probably damaging 0.99
R7602:Exo5 UTSW 4 120921621 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAAGCTCCAAGGTCACTC -3'
(R):5'- GGCACAGAGATTGTAGCCTTTG -3'

Sequencing Primer
(F):5'- TGAAAGCTCCAAGGTCACTCTAACAC -3'
(R):5'- CACAGAGATTGTAGCCTTTGAAGAG -3'
Posted On2016-07-06