Incidental Mutation 'R5178:Sp4'
ID399501
Institutional Source Beutler Lab
Gene Symbol Sp4
Ensembl Gene ENSMUSG00000025323
Gene Nametrans-acting transcription factor 4
Synonyms5730497N03Rik, HF1-b, HF-1b
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118234933-118301440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118261889 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 580 (V580A)
Ref Sequence ENSEMBL: ENSMUSP00000152603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026367] [ENSMUST00000221844] [ENSMUST00000222314]
Predicted Effect unknown
Transcript: ENSMUST00000026367
AA Change: V580A
SMART Domains Protein: ENSMUSP00000026367
Gene: ENSMUSG00000025323
AA Change: V580A

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 146 N/A INTRINSIC
internal_repeat_1 157 255 4.15e-6 PROSPERO
internal_repeat_2 203 265 5.92e-5 PROSPERO
low complexity region 272 296 N/A INTRINSIC
low complexity region 300 342 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
low complexity region 392 421 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
internal_repeat_2 451 506 5.92e-5 PROSPERO
internal_repeat_1 461 539 4.15e-6 PROSPERO
low complexity region 540 549 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
low complexity region 629 638 N/A INTRINSIC
ZnF_C2H2 645 669 2.82e0 SMART
ZnF_C2H2 675 699 7.37e-4 SMART
ZnF_C2H2 705 727 1.47e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000221844
AA Change: V25A
Predicted Effect possibly damaging
Transcript: ENSMUST00000222314
AA Change: V580A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that can bind to the GC promoter region of a variety of genes, including those of the photoreceptor signal transduction system. The encoded protein binds to the same sites in promoter CpG islands as does the transcription factor SP1, although its expression is much more restricted compared to that of SP1. This gene may be involved in bipolar disorder and schizophrenia. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac arrhythmias and most die shortly after birth. Surviving males complete spermatogenesis but do not copulate, while females show delayed sexual maturation and reduction in spleen, thymus, and uterus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Sp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Sp4 APN 12 118299549 missense probably damaging 0.99
IGL02817:Sp4 APN 12 118299552 missense probably damaging 1.00
IGL02833:Sp4 APN 12 118261881 missense probably benign 0.05
Speck UTSW 12 118300811 splice site probably null
R0128:Sp4 UTSW 12 118300816 splice site probably benign
R0130:Sp4 UTSW 12 118300816 splice site probably benign
R0398:Sp4 UTSW 12 118298673 missense possibly damaging 0.79
R0626:Sp4 UTSW 12 118299579 missense probably damaging 1.00
R1193:Sp4 UTSW 12 118299246 missense possibly damaging 0.94
R1775:Sp4 UTSW 12 118299600 missense probably damaging 0.99
R4724:Sp4 UTSW 12 118261809 missense probably benign
R4861:Sp4 UTSW 12 118300811 splice site probably null
R4861:Sp4 UTSW 12 118300811 splice site probably null
R4969:Sp4 UTSW 12 118299606 missense probably damaging 0.96
R5049:Sp4 UTSW 12 118254472 missense probably benign 0.04
R5208:Sp4 UTSW 12 118299546 missense probably damaging 1.00
R5722:Sp4 UTSW 12 118299241 missense possibly damaging 0.66
R6318:Sp4 UTSW 12 118238178 missense probably damaging 1.00
R6619:Sp4 UTSW 12 118299342 missense possibly damaging 0.92
R6917:Sp4 UTSW 12 118299173 missense probably damaging 1.00
R7195:Sp4 UTSW 12 118300072 missense possibly damaging 0.92
R7614:Sp4 UTSW 12 118254439 missense possibly damaging 0.82
Z1177:Sp4 UTSW 12 118300059 missense not run
Predicted Primers PCR Primer
(F):5'- CCAGGGTGAAAACAGCAGTTAC -3'
(R):5'- CAGCAGCTGGGTAAATATCGTATC -3'

Sequencing Primer
(F):5'- GGTGAAAACAGCAGTTACCTTCCTTC -3'
(R):5'- GGGTAAATATCGTATCATTAAGCCC -3'
Posted On2016-07-06