Incidental Mutation 'R2401:Exo5'
ID 248679
Institutional Source Beutler Lab
Gene Symbol Exo5
Ensembl Gene ENSMUSG00000028629
Gene Name exonuclease 5
Synonyms
MMRRC Submission 040367-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2401 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 120921196-120925017 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120921997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 224 (I224V)
Ref Sequence ENSEMBL: ENSMUSP00000136408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030375] [ENSMUST00000144114] [ENSMUST00000156836] [ENSMUST00000177880]
AlphaFold Q9CXP9
Predicted Effect probably damaging
Transcript: ENSMUST00000030375
AA Change: I224V

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030375
Gene: ENSMUSG00000028629
AA Change: I224V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Exo5 71 355 1.3e-82 PFAM
Pfam:PDDEXK_1 92 353 2.4e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144114
AA Change: I10V

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116454
Gene: ENSMUSG00000028629
AA Change: I10V

DomainStartEndE-ValueType
Pfam:Exo5 1 141 2.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156836
SMART Domains Protein: ENSMUSP00000118041
Gene: ENSMUSG00000028629

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Exo5 71 133 1.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177880
AA Change: I224V

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136408
Gene: ENSMUSG00000028629
AA Change: I224V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Exo5 71 196 1.1e-30 PFAM
Pfam:PDDEXK_1 94 353 6.5e-7 PFAM
Pfam:Exo5 190 355 1.5e-28 PFAM
Meta Mutation Damage Score 0.3738 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-stranded DNA (ssDNA)-specific exonuclease that can slide along the DNA before cutting it. However, human replication protein A binds ssDNA and restricts sliding of the encoded protein, providing a 5'-directionality to the enzyme. This protein localizes to nuclear repair loci after DNA damage. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 N11K possibly damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc178 C T 18: 22,131,414 probably null Het
Ccdc36 G T 9: 108,413,006 T133N possibly damaging Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Dmrta1 A T 4: 89,691,616 D271V probably benign Het
Efcab3 T A 11: 105,072,318 probably null Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Itgb4 A G 11: 116,006,563 D1534G possibly damaging Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kif16b C T 2: 142,756,122 V527I probably benign Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfm4 A G 14: 80,021,752 Y447C probably damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Stil A G 4: 115,016,286 R369G probably null Het
Ttc41 T C 10: 86,724,374 I387T probably benign Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Exo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02932:Exo5 APN 4 120922545 missense probably benign 0.01
IGL03063:Exo5 APN 4 120921633 missense possibly damaging 0.60
R0417:Exo5 UTSW 4 120922072 missense probably damaging 1.00
R0540:Exo5 UTSW 4 120921981 missense probably damaging 0.99
R0609:Exo5 UTSW 4 120921684 missense probably damaging 1.00
R1126:Exo5 UTSW 4 120922125 missense probably damaging 1.00
R4658:Exo5 UTSW 4 120922551 missense probably benign
R5093:Exo5 UTSW 4 120922317 missense probably damaging 1.00
R5125:Exo5 UTSW 4 120921537 critical splice donor site probably null
R5178:Exo5 UTSW 4 120921537 critical splice donor site probably null
R6492:Exo5 UTSW 4 120921537 utr 3 prime probably benign
R6736:Exo5 UTSW 4 120921756 missense probably damaging 0.99
R7602:Exo5 UTSW 4 120921621 missense probably benign 0.00
R8425:Exo5 UTSW 4 120922363 missense probably benign 0.04
R8699:Exo5 UTSW 4 120921996 missense probably damaging 1.00
R8806:Exo5 UTSW 4 120922405 missense probably benign 0.01
R9057:Exo5 UTSW 4 120921989 missense probably damaging 1.00
R9448:Exo5 UTSW 4 120921691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCAATAGCTGGGAGATCAGACAG -3'
(R):5'- TGATTCCTGCCCTACAGTCG -3'

Sequencing Primer
(F):5'- GTGTAAGAGACAAGAAAACCAGTTCC -3'
(R):5'- CGCGTCAGAGAGTTTCCAGTG -3'
Posted On 2014-11-11