Incidental Mutation 'R5178:Tbc1d19'
ID399456
Institutional Source Beutler Lab
Gene Symbol Tbc1d19
Ensembl Gene ENSMUSG00000039178
Gene NameTBC1 domain family, member 19
Synonyms
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location53809606-53903965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53889325 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 413 (S413T)
Ref Sequence ENSEMBL: ENSMUSP00000040585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037337] [ENSMUST00000201958]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037337
AA Change: S413T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040585
Gene: ENSMUSG00000039178
AA Change: S413T

DomainStartEndE-ValueType
TBC 248 496 8.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202880
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Tbc1d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Tbc1d19 APN 5 53897062 nonsense probably null
IGL01684:Tbc1d19 APN 5 53856879 missense probably benign 0.31
IGL02476:Tbc1d19 APN 5 53889413 splice site probably null
IGL02869:Tbc1d19 APN 5 53835217 missense probably benign 0.02
IGL03036:Tbc1d19 APN 5 53897047 missense probably damaging 1.00
IGL03099:Tbc1d19 APN 5 53883655 splice site probably benign
LCD18:Tbc1d19 UTSW 5 53816709 intron probably benign
R0194:Tbc1d19 UTSW 5 53860156 missense probably damaging 1.00
R1729:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1776:Tbc1d19 UTSW 5 53889311 splice site probably null
R1784:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1902:Tbc1d19 UTSW 5 53829353 missense probably benign 0.00
R3431:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R3432:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R4333:Tbc1d19 UTSW 5 53872277 missense possibly damaging 0.93
R4335:Tbc1d19 UTSW 5 53872277 missense possibly damaging 0.93
R4681:Tbc1d19 UTSW 5 53872253 missense probably damaging 1.00
R4812:Tbc1d19 UTSW 5 53809806 missense probably damaging 0.99
R5214:Tbc1d19 UTSW 5 53849841 missense probably benign 0.00
R6265:Tbc1d19 UTSW 5 53837924 missense probably benign 0.06
R6372:Tbc1d19 UTSW 5 53856910 missense possibly damaging 0.55
R6494:Tbc1d19 UTSW 5 53829383 missense probably benign 0.13
R6495:Tbc1d19 UTSW 5 53889213 intron probably null
R6612:Tbc1d19 UTSW 5 53809845 missense possibly damaging 0.88
R6787:Tbc1d19 UTSW 5 53835249 splice site probably null
R6965:Tbc1d19 UTSW 5 53856924 critical splice donor site probably null
R7275:Tbc1d19 UTSW 5 53872276 missense probably damaging 1.00
R7642:Tbc1d19 UTSW 5 53856918 missense probably damaging 0.98
R7655:Tbc1d19 UTSW 5 53897035 missense probably damaging 1.00
R7656:Tbc1d19 UTSW 5 53897035 missense probably damaging 1.00
X0026:Tbc1d19 UTSW 5 53835247 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGGCTCACAAAATGGCAGG -3'
(R):5'- TAACATGGTCGCTTTGAGGG -3'

Sequencing Primer
(F):5'- CAAAATGGCAGGGTTTTTATAAAGG -3'
(R):5'- AGGGGAGAACTGTTGCCTCTC -3'
Posted On2016-07-06