Incidental Mutation 'R5178:Vmn2r95'
ID399518
Institutional Source Beutler Lab
Gene Symbol Vmn2r95
Ensembl Gene ENSMUSG00000091631
Gene Namevomeronasal 2, receptor 95
Synonyms
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18424078-18460905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18440075 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 250 (T250A)
Ref Sequence ENSEMBL: ENSMUSP00000156383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]
Predicted Effect probably benign
Transcript: ENSMUST00000166327
AA Change: T250A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631
AA Change: T250A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 462 1.8e-35 PFAM
Pfam:NCD3G 509 562 3.2e-20 PFAM
Pfam:7tm_3 594 830 3.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232090
AA Change: T250A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000232464
AA Change: T250A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Vmn2r95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r95 APN 17 18452328 utr 3 prime probably benign
IGL01479:Vmn2r95 APN 17 18443862 missense probably damaging 1.00
IGL01890:Vmn2r95 APN 17 18451475 missense probably damaging 1.00
IGL01986:Vmn2r95 APN 17 18440211 missense probably benign 0.06
IGL02113:Vmn2r95 APN 17 18439907 missense possibly damaging 0.47
IGL02154:Vmn2r95 APN 17 18451986 missense probably benign 0.16
IGL02190:Vmn2r95 APN 17 18451776 missense probably benign 0.00
IGL02412:Vmn2r95 APN 17 18439956 missense probably damaging 1.00
IGL02550:Vmn2r95 APN 17 18451732 missense probably damaging 1.00
IGL02679:Vmn2r95 APN 17 18443854 missense probably damaging 1.00
IGL02691:Vmn2r95 APN 17 18451858 missense probably benign 0.07
IGL02990:Vmn2r95 APN 17 18452036 nonsense probably null
IGL03032:Vmn2r95 APN 17 18452313 missense probably benign 0.00
R0416:Vmn2r95 UTSW 17 18441402 missense probably damaging 1.00
R0448:Vmn2r95 UTSW 17 18451743 missense possibly damaging 0.92
R0514:Vmn2r95 UTSW 17 18451582 missense probably benign
R0519:Vmn2r95 UTSW 17 18439503 missense probably damaging 1.00
R0539:Vmn2r95 UTSW 17 18452100 missense probably damaging 1.00
R1501:Vmn2r95 UTSW 17 18439856 missense probably damaging 0.99
R1598:Vmn2r95 UTSW 17 18452313 missense probably benign 0.03
R1613:Vmn2r95 UTSW 17 18440639 splice site probably benign
R1861:Vmn2r95 UTSW 17 18452268 missense probably damaging 1.00
R1921:Vmn2r95 UTSW 17 18424313 missense probably benign 0.11
R1986:Vmn2r95 UTSW 17 18451543 missense probably benign
R2031:Vmn2r95 UTSW 17 18439455 missense possibly damaging 0.94
R2040:Vmn2r95 UTSW 17 18441299 missense probably damaging 1.00
R3608:Vmn2r95 UTSW 17 18439973 missense possibly damaging 0.47
R3727:Vmn2r95 UTSW 17 18441482 nonsense probably null
R3953:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3955:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3957:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R4474:Vmn2r95 UTSW 17 18452245 missense probably damaging 1.00
R4672:Vmn2r95 UTSW 17 18452151 missense probably damaging 1.00
R4850:Vmn2r95 UTSW 17 18451653 missense probably damaging 1.00
R5054:Vmn2r95 UTSW 17 18451446 missense possibly damaging 0.63
R5980:Vmn2r95 UTSW 17 18441362 missense probably benign
R6183:Vmn2r95 UTSW 17 18443930 missense probably damaging 0.99
R6276:Vmn2r95 UTSW 17 18451470 missense possibly damaging 0.96
R6651:Vmn2r95 UTSW 17 18440360 missense probably damaging 1.00
R6682:Vmn2r95 UTSW 17 18440227 missense probably damaging 1.00
R6797:Vmn2r95 UTSW 17 18452289 utr 3 prime probably benign
R6799:Vmn2r95 UTSW 17 18439293 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443919 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443920 missense probably damaging 1.00
R6982:Vmn2r95 UTSW 17 18452061 missense probably damaging 1.00
R7203:Vmn2r95 UTSW 17 18441315 missense probably benign 0.01
R7226:Vmn2r95 UTSW 17 18451983 missense possibly damaging 0.90
R7240:Vmn2r95 UTSW 17 18451963 missense probably benign 0.15
R7383:Vmn2r95 UTSW 17 18440472 missense probably benign 0.06
R7614:Vmn2r95 UTSW 17 18440090 missense probably benign
R7755:Vmn2r95 UTSW 17 18424105 start codon destroyed probably null 0.99
Z1088:Vmn2r95 UTSW 17 18440401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCATGGTCAGTATCCTTCTC -3'
(R):5'- GAGTCTAACATGAAATAGTCAGCTCTG -3'

Sequencing Primer
(F):5'- AGTATCCTTCTCTCTACCAGATGG -3'
(R):5'- GTCAGCTCTGTCAATAACATGATG -3'
Posted On2016-07-06