Incidental Mutation 'R5198:Zfp616'
ID400502
Institutional Source Beutler Lab
Gene Symbol Zfp616
Ensembl Gene ENSMUSG00000069476
Gene Namezinc finger protein 616
SynonymsGm12330
MMRRC Submission 042774-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5198 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74069955-74087292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74083510 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 293 (V293I)
Ref Sequence ENSEMBL: ENSMUSP00000104103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074813] [ENSMUST00000108463] [ENSMUST00000116546] [ENSMUST00000178159]
Predicted Effect probably benign
Transcript: ENSMUST00000074813
SMART Domains Protein: ENSMUSP00000074365
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108463
AA Change: V293I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104103
Gene: ENSMUSG00000069476
AA Change: V293I

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 249 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116546
SMART Domains Protein: ENSMUSP00000112245
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137407
Predicted Effect probably benign
Transcript: ENSMUST00000178159
AA Change: V202I

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136549
Gene: ENSMUSG00000069476
AA Change: V202I

DomainStartEndE-ValueType
internal_repeat_1 125 447 7.61e-6 PROSPERO
ZnF_C2H2 452 474 3.11e-2 SMART
ZnF_C2H2 509 531 2.61e-4 SMART
ZnF_C2H2 537 559 1.47e-3 SMART
ZnF_C2H2 565 587 5.21e-4 SMART
ZnF_C2H2 593 615 1.22e-4 SMART
ZnF_C2H2 621 643 2.57e-3 SMART
ZnF_C2H2 649 671 9.22e-5 SMART
ZnF_C2H2 677 699 5.9e-3 SMART
ZnF_C2H2 705 727 4.94e-5 SMART
ZnF_C2H2 733 755 8.34e-3 SMART
ZnF_C2H2 761 783 1.6e-4 SMART
ZnF_C2H2 789 811 6.88e-4 SMART
ZnF_C2H2 817 839 1.6e-4 SMART
ZnF_C2H2 845 867 1.3e-4 SMART
ZnF_C2H2 873 895 7.37e-4 SMART
ZnF_C2H2 901 923 1.6e-4 SMART
ZnF_C2H2 929 951 1.3e-4 SMART
ZnF_C2H2 957 979 3.95e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik G A 2: 23,212,461 C121Y probably damaging Het
Abcc9 A G 6: 142,626,000 V1121A probably benign Het
Adamtsl3 A C 7: 82,611,798 K1647Q possibly damaging Het
Adgrb1 A T 15: 74,543,701 Q710L probably null Het
Alox12 T C 11: 70,254,417 E110G probably damaging Het
Cep152 T A 2: 125,587,624 M738L probably benign Het
Cma2 T C 14: 55,972,075 V38A probably benign Het
Dlc1 C T 8: 36,938,398 G79D probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dus3l A G 17: 56,769,574 I585V probably benign Het
Etl4 A G 2: 20,713,387 Y313C probably damaging Het
Fbxw15 C A 9: 109,558,174 S251I probably benign Het
Gata4 G A 14: 63,200,451 S417L probably benign Het
Gdpd5 T A 7: 99,438,308 Y60N probably damaging Het
Gm17669 T C 18: 67,562,556 M57T probably benign Het
Gpr39 A T 1: 125,677,436 I34F probably benign Het
Iffo2 T A 4: 139,575,217 D90E probably benign Het
Il17c A G 8: 122,422,369 D84G possibly damaging Het
Itih3 T C 14: 30,912,649 T134A probably benign Het
Lama2 G A 10: 27,347,003 A429V probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mug1 G A 6: 121,874,562 R806H probably damaging Het
Naaa G A 5: 92,268,045 R65* probably null Het
Nacc2 C T 2: 26,060,334 M463I probably benign Het
Nemf A G 12: 69,356,047 S72P probably damaging Het
Nudt7 G A 8: 114,135,445 probably null Het
Olfr1272 T C 2: 90,296,393 Q156R probably damaging Het
Olfr625-ps1 T C 7: 103,682,729 S4P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T C 19: 5,139,297 D757G probably benign Het
Pkd2 A C 5: 104,483,092 I461L probably benign Het
Pramel5 T G 4: 144,273,494 probably benign Het
Ptgdr G C 14: 44,858,843 F137L probably damaging Het
Pum1 T A 4: 130,779,879 C1085* probably null Het
Rfx3 T C 19: 27,830,776 D189G probably damaging Het
Rlf T A 4: 121,148,553 K1077* probably null Het
Slc25a30 C A 14: 75,769,616 D147Y probably benign Het
Smap2 T C 4: 121,016,787 E22G possibly damaging Het
Szt2 T C 4: 118,388,322 T1098A probably benign Het
Tbcc T C 17: 46,890,862 F58S probably damaging Het
Tekt3 G A 11: 63,070,308 R101H probably damaging Het
Vcan T A 13: 89,690,872 E2184D probably damaging Het
Vkorc1 T C 7: 127,894,588 E18G probably benign Het
Vmn1r68 T C 7: 10,527,796 H125R probably benign Het
Vmn2r63 C A 7: 42,903,745 V696L probably benign Het
Wdr59 G A 8: 111,481,988 H421Y probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp112 T C 7: 24,124,856 V83A possibly damaging Het
Other mutations in Zfp616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zfp616 APN 11 74083613 missense probably damaging 0.98
IGL00570:Zfp616 APN 11 74085805 missense probably benign 0.03
IGL00594:Zfp616 APN 11 74082963 missense possibly damaging 0.72
IGL01861:Zfp616 APN 11 74082916 missense possibly damaging 0.53
IGL03022:Zfp616 APN 11 74082974 missense possibly damaging 0.85
R0197:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0442:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R0497:Zfp616 UTSW 11 74083480 missense probably benign 0.00
R0651:Zfp616 UTSW 11 74083729 nonsense probably null
R0730:Zfp616 UTSW 11 74084822 missense probably damaging 1.00
R0883:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0926:Zfp616 UTSW 11 74085818 missense probably benign 0.04
R0940:Zfp616 UTSW 11 74085024 missense probably damaging 1.00
R1068:Zfp616 UTSW 11 74082941 makesense probably null
R1272:Zfp616 UTSW 11 74085236 missense probably benign 0.08
R1446:Zfp616 UTSW 11 74083238 unclassified probably null
R1482:Zfp616 UTSW 11 74083977 missense possibly damaging 0.72
R1553:Zfp616 UTSW 11 74083918 missense possibly damaging 0.53
R1564:Zfp616 UTSW 11 74084722 missense probably damaging 1.00
R1728:Zfp616 UTSW 11 74085771 missense probably damaging 0.99
R1796:Zfp616 UTSW 11 74085845 missense probably damaging 0.98
R1797:Zfp616 UTSW 11 74085279 nonsense probably null
R1993:Zfp616 UTSW 11 74084969 missense probably benign 0.08
R2026:Zfp616 UTSW 11 74083587 missense possibly damaging 0.86
R2124:Zfp616 UTSW 11 74083043 unclassified probably null
R2126:Zfp616 UTSW 11 74085403 missense probably benign 0.08
R2199:Zfp616 UTSW 11 74084630 missense possibly damaging 0.58
R2265:Zfp616 UTSW 11 74085463 missense possibly damaging 0.89
R2404:Zfp616 UTSW 11 74084856 missense probably damaging 1.00
R2508:Zfp616 UTSW 11 74083295 missense probably benign 0.01
R2519:Zfp616 UTSW 11 74084268 nonsense probably null
R3103:Zfp616 UTSW 11 74071735 missense probably benign 0.01
R3611:Zfp616 UTSW 11 74083442 missense possibly damaging 0.53
R3703:Zfp616 UTSW 11 74083319 nonsense probably null
R3744:Zfp616 UTSW 11 74083987 missense probably benign 0.01
R4043:Zfp616 UTSW 11 74085282 missense possibly damaging 0.50
R4273:Zfp616 UTSW 11 74083700 missense probably benign 0.00
R4384:Zfp616 UTSW 11 74083179 missense possibly damaging 0.94
R4469:Zfp616 UTSW 11 74071124 missense probably damaging 0.98
R4560:Zfp616 UTSW 11 74083034 missense probably benign 0.00
R4821:Zfp616 UTSW 11 74084207 missense probably benign 0.41
R4844:Zfp616 UTSW 11 74084399 missense probably benign 0.10
R4948:Zfp616 UTSW 11 74084004 missense possibly damaging 0.72
R5007:Zfp616 UTSW 11 74083817 missense possibly damaging 0.96
R5344:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R5918:Zfp616 UTSW 11 74083260 missense possibly damaging 0.70
R5933:Zfp616 UTSW 11 74083126 missense probably damaging 0.96
R6084:Zfp616 UTSW 11 74083846 nonsense probably null
R6421:Zfp616 UTSW 11 74083870 missense possibly damaging 0.53
R6494:Zfp616 UTSW 11 74085192 missense probably damaging 1.00
R6523:Zfp616 UTSW 11 74083142 missense possibly damaging 0.79
R6849:Zfp616 UTSW 11 74085450 missense possibly damaging 0.70
R6910:Zfp616 UTSW 11 74085002 missense probably damaging 1.00
R7146:Zfp616 UTSW 11 74085261 missense possibly damaging 0.61
R7213:Zfp616 UTSW 11 74085863 missense probably benign 0.05
R7302:Zfp616 UTSW 11 74085379 missense probably benign 0.08
R7391:Zfp616 UTSW 11 74085329 missense probably benign 0.08
R7654:Zfp616 UTSW 11 74083187 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGTGAATAAACCCACTTCCCTG -3'
(R):5'- ACATAGCCTGTCTACTATCATGG -3'

Sequencing Primer
(F):5'- CACTTCCCTGAAGCATTTATCAAG -3'
(R):5'- GCCTGTCTACTATCATGGTTATAATG -3'
Posted On2016-07-06