Incidental Mutation 'R5208:Chn2'
ID402148
Institutional Source Beutler Lab
Gene Symbol Chn2
Ensembl Gene ENSMUSG00000004633
Gene Namechimerin 2
Synonyms4930557O16Rik, 1700026N20Rik
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location54039554-54301810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54295801 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 201 (I201F)
Ref Sequence ENSEMBL: ENSMUSP00000066078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046856] [ENSMUST00000067741] [ENSMUST00000114401] [ENSMUST00000114402] [ENSMUST00000146114] [ENSMUST00000203091] [ENSMUST00000203941] [ENSMUST00000204115] [ENSMUST00000204746] [ENSMUST00000204921]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046856
AA Change: I337F

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035908
Gene: ENSMUSG00000004633
AA Change: I337F

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SH2 57 136 7.23e-16 SMART
C1 215 264 1.88e-15 SMART
RhoGAP 288 465 2.73e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067741
AA Change: I201F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066078
Gene: ENSMUSG00000004633
AA Change: I201F

DomainStartEndE-ValueType
C1 79 128 1.88e-15 SMART
RhoGAP 152 329 2.73e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114401
AA Change: I146F

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110043
Gene: ENSMUSG00000004633
AA Change: I146F

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 274 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114402
AA Change: I146F

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110044
Gene: ENSMUSG00000004633
AA Change: I146F

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 224 2.07e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145111
Predicted Effect possibly damaging
Transcript: ENSMUST00000146114
AA Change: I151F

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114476
Gene: ENSMUSG00000004633
AA Change: I151F

DomainStartEndE-ValueType
C1 29 78 1.88e-15 SMART
RhoGAP 102 279 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203091
SMART Domains Protein: ENSMUSP00000145008
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
Pfam:RhoGAP 155 196 5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203941
SMART Domains Protein: ENSMUSP00000145314
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
RhoGAP 101 225 1.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204115
SMART Domains Protein: ENSMUSP00000145507
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 101 257 3.7e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204746
AA Change: I143F

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144983
Gene: ENSMUSG00000004633
AA Change: I143F

DomainStartEndE-ValueType
RhoGAP 101 271 4.7e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204921
SMART Domains Protein: ENSMUSP00000145231
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 152 283 4.9e-37 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired infrapyramidal tract neuron prunning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Chn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chn2 APN 6 54295922 critical splice donor site probably null
IGL02158:Chn2 APN 6 54300245 unclassified probably benign
IGL02618:Chn2 APN 6 54220437 missense probably damaging 1.00
IGL02807:Chn2 APN 6 54295913 missense possibly damaging 0.80
IGL03357:Chn2 APN 6 54194077 missense probably benign 0.02
R0002:Chn2 UTSW 6 54273113 missense probably benign 0.08
R0123:Chn2 UTSW 6 54290451 splice site probably benign
R0225:Chn2 UTSW 6 54290451 splice site probably benign
R1478:Chn2 UTSW 6 54293080 missense probably damaging 1.00
R1905:Chn2 UTSW 6 54286121 missense probably damaging 1.00
R3769:Chn2 UTSW 6 54290411 missense probably damaging 1.00
R3946:Chn2 UTSW 6 54269426 unclassified probably benign
R4125:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4127:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4128:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4614:Chn2 UTSW 6 54290403 missense probably damaging 1.00
R4616:Chn2 UTSW 6 54290403 missense probably damaging 1.00
R5063:Chn2 UTSW 6 54290287 nonsense probably null
R5121:Chn2 UTSW 6 54218561 missense possibly damaging 0.57
R5240:Chn2 UTSW 6 54220695 missense probably benign
R5348:Chn2 UTSW 6 54300218 missense probably damaging 0.99
R5861:Chn2 UTSW 6 54290374 missense probably damaging 1.00
R6539:Chn2 UTSW 6 54173461 splice site probably null
R6824:Chn2 UTSW 6 54272953 missense probably benign 0.00
R7194:Chn2 UTSW 6 54286177 splice site probably null
R7740:Chn2 UTSW 6 54300171 missense probably benign 0.18
R7765:Chn2 UTSW 6 54298152 critical splice donor site probably null
R7997:Chn2 UTSW 6 54290285 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATCTACCCTGCTGCACGC -3'
(R):5'- TTGGAAGATTTTCATTCCCCTGAG -3'

Sequencing Primer
(F):5'- TGCTGCACGCTTGTCTG -3'
(R):5'- GAAGATTTTCATTCCCCTGAGATCAG -3'
Posted On2016-07-22