Incidental Mutation 'R5208:Zfat'
ID402178
Institutional Source Beutler Lab
Gene Symbol Zfat
Ensembl Gene ENSMUSG00000022335
Gene Namezinc finger and AT hook domain containing
SynonymsLOC380993, Zfat1, Zfp406
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location68083764-68258856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68180721 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 401 (I401N)
Ref Sequence ENSEMBL: ENSMUSP00000125732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159430] [ENSMUST00000160248] [ENSMUST00000162054] [ENSMUST00000162173]
PDB Structure
Solution structure of the 5th C2H2 zinc finger of mouse Zinc finger protein 406 [SOLUTION NMR]
Solution structure of the 8th C2H2 zinc finger of mouse Zinc finger protein 406 [SOLUTION NMR]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159430
SMART Domains Protein: ENSMUSP00000124420
Gene: ENSMUSG00000022335

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 158 174 N/A INTRINSIC
ZnF_C2H2 209 231 1.47e-3 SMART
ZnF_C2H2 237 259 1.18e-2 SMART
ZnF_C2H2 264 287 2.36e-2 SMART
ZnF_C2H2 292 315 4.4e-2 SMART
ZnF_C2H2 342 364 1.67e-2 SMART
ZnF_C2H2 370 392 1.33e-1 SMART
ZnF_C2H2 396 419 2.05e-2 SMART
low complexity region 539 555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160248
AA Change: I408N

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125257
Gene: ENSMUSG00000022335
AA Change: I408N

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1073 1082 N/A INTRINSIC
low complexity region 1139 1149 N/A INTRINSIC
low complexity region 1218 1236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162054
AA Change: I401N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125732
Gene: ENSMUSG00000022335
AA Change: I401N

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 264 286 1.47e-3 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
ZnF_C2H2 319 342 2.36e-2 SMART
ZnF_C2H2 347 370 4.4e-2 SMART
ZnF_C2H2 397 419 1.67e-2 SMART
ZnF_C2H2 425 447 1.33e-1 SMART
ZnF_C2H2 451 474 2.05e-2 SMART
low complexity region 594 610 N/A INTRINSIC
ZnF_C2H2 730 752 1.43e-1 SMART
ZnF_C2H2 758 781 3.52e-1 SMART
ZnF_C2H2 786 810 5.59e-4 SMART
ZnF_C2H2 818 841 3.83e-2 SMART
ZnF_C2H2 868 891 3.95e1 SMART
ZnF_C2H2 897 919 6.88e-4 SMART
ZnF_C2H2 925 947 8.94e-3 SMART
ZnF_C2H2 954 976 2.27e-4 SMART
ZnF_C2H2 982 1005 9.3e-1 SMART
ZnF_C2H2 1029 1052 5.21e-4 SMART
low complexity region 1121 1131 N/A INTRINSIC
low complexity region 1200 1218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162173
AA Change: I408N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124974
Gene: ENSMUSG00000022335
AA Change: I408N

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1133 1151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely binds DNA and functions as a transcriptional regulator involved in apoptosis and cell survival. This gene resides in a susceptibility locus for autoimmune thyroid disease (AITD) on chromosome 8q24. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with failure to initiation of embryo turning, abnormal embryonic hematopoiesis, abnormal spongiotrophoblast layer morphology, abnormal visceral yolk sac blood island morphology and pale yolk sac. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Zfat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Zfat APN 15 68170222 missense possibly damaging 0.92
IGL00862:Zfat APN 15 68258663 splice site probably null
IGL01021:Zfat APN 15 68170166 missense possibly damaging 0.50
IGL01152:Zfat APN 15 68110504 missense probably damaging 1.00
IGL01733:Zfat APN 15 68180730 missense probably damaging 1.00
IGL01873:Zfat APN 15 68224895 missense probably benign 0.00
IGL01990:Zfat APN 15 68224817 missense probably damaging 1.00
IGL02066:Zfat APN 15 68180829 missense probably damaging 1.00
IGL02664:Zfat APN 15 68180721 missense probably damaging 1.00
IGL02955:Zfat APN 15 68181114 missense probably damaging 0.98
IGL03201:Zfat APN 15 68165909 missense probably damaging 1.00
R0145:Zfat UTSW 15 68187099 missense possibly damaging 0.95
R0408:Zfat UTSW 15 68180292 missense probably benign 0.10
R0633:Zfat UTSW 15 68180803 missense probably damaging 1.00
R1147:Zfat UTSW 15 68212583 splice site probably benign
R1508:Zfat UTSW 15 68178751 missense probably damaging 1.00
R1513:Zfat UTSW 15 68212680 missense probably damaging 1.00
R1641:Zfat UTSW 15 68180110 missense probably benign 0.19
R1889:Zfat UTSW 15 68101539 missense probably benign 0.00
R1959:Zfat UTSW 15 68146543 missense probably benign 0.32
R2030:Zfat UTSW 15 68118934 critical splice donor site probably null
R2202:Zfat UTSW 15 68179860 missense probably benign 0.36
R2340:Zfat UTSW 15 68101541 missense probably damaging 0.99
R3440:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68101581 missense probably damaging 0.99
R4406:Zfat UTSW 15 68180191 missense probably benign 0.00
R4649:Zfat UTSW 15 68184476 missense probably damaging 1.00
R4710:Zfat UTSW 15 68180282 missense probably benign
R4712:Zfat UTSW 15 68110475 critical splice donor site probably null
R4745:Zfat UTSW 15 68180374 missense probably benign 0.09
R4862:Zfat UTSW 15 68180110 missense probably benign 0.02
R5015:Zfat UTSW 15 68178913 missense probably damaging 1.00
R5075:Zfat UTSW 15 68180230 missense probably benign
R5277:Zfat UTSW 15 68165909 missense probably damaging 1.00
R5303:Zfat UTSW 15 68110486 missense probably damaging 1.00
R5328:Zfat UTSW 15 68179828 missense probably damaging 0.99
R5642:Zfat UTSW 15 68180916 missense probably damaging 1.00
R5659:Zfat UTSW 15 68119013 missense probably damaging 1.00
R5947:Zfat UTSW 15 68179957 missense probably benign
R6046:Zfat UTSW 15 68180777 missense probably damaging 0.99
R6315:Zfat UTSW 15 68084462 missense probably damaging 1.00
R6342:Zfat UTSW 15 68180982 missense probably damaging 1.00
R6573:Zfat UTSW 15 68165854 missense probably damaging 1.00
R6789:Zfat UTSW 15 68084386 missense probably damaging 1.00
R7028:Zfat UTSW 15 68180452 missense probably damaging 1.00
R7033:Zfat UTSW 15 68181015 missense probably damaging 1.00
R7039:Zfat UTSW 15 68180362 missense probably benign
R7065:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7144:Zfat UTSW 15 68178782 missense probably benign 0.12
R7208:Zfat UTSW 15 68180007 missense probably benign 0.39
R7330:Zfat UTSW 15 68212751 missense probably benign 0.00
R7345:Zfat UTSW 15 68105043 missense probably damaging 1.00
R7378:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7405:Zfat UTSW 15 68184485 missense probably damaging 1.00
R7481:Zfat UTSW 15 68178866 nonsense probably null
Z1088:Zfat UTSW 15 68187101 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATGCACCTCTCGGATATG -3'
(R):5'- ACATCGAGCGGGTACACAAG -3'

Sequencing Primer
(F):5'- CTGATGGAGCTGACGAACTTC -3'
(R):5'- GAAGATCAAACAGCATTGCCG -3'
Posted On2016-07-22