Mutagenetix > Incidental Mutations

Incidental Mutation 'R5215:Drosha'

403445

Institutional Source

Beutler Lab

Gene Symbol

Drosha

Ensembl Gene

ENSMUSG00000022191

Gene Name

drosha, ribonuclease type III

Synonyms

1110013A17Rik, Rnasen, Etohi2

MMRRC Submission

042788-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R5215 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12824815-12935291 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 12885133 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]

Predicted Effect

probably benign
Transcript: ENSMUST00000090292

SMART Domains

Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
low complexity region	43	69	N/A	INTRINSIC
low complexity region	72	102	N/A	INTRINSIC
low complexity region	109	137	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	185	200	N/A	INTRINSIC
low complexity region	227	269	N/A	INTRINSIC
low complexity region	273	301	N/A	INTRINSIC
low complexity region	357	370	N/A	INTRINSIC
low complexity region	387	410	N/A	INTRINSIC
low complexity region	472	499	N/A	INTRINSIC
SCOP:d1jfza_	878	902	4e-4	SMART
RIBOc	942	1076	1.73e-45	SMART
Blast:RIBOc	1086	1112	1e-6	BLAST
RIBOc	1121	1253	1.6e-49	SMART
DSRM	1260	1332	5.75e-20	SMART
coiled coil region	1346	1370	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150211

Predicted Effect

probably benign
Transcript: ENSMUST00000169061

SMART Domains

Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
low complexity region	43	69	N/A	INTRINSIC
low complexity region	72	102	N/A	INTRINSIC
low complexity region	109	137	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	185	200	N/A	INTRINSIC
low complexity region	227	269	N/A	INTRINSIC
low complexity region	273	301	N/A	INTRINSIC
low complexity region	357	370	N/A	INTRINSIC
low complexity region	387	410	N/A	INTRINSIC
low complexity region	472	499	N/A	INTRINSIC
SCOP:d1jfza_	878	902	4e-4	SMART
RIBOc	942	1076	1.73e-45	SMART
Blast:RIBOc	1086	1112	1e-6	BLAST
RIBOc	1121	1253	1.6e-49	SMART
DSRM	1260	1332	5.75e-20	SMART
coiled coil region	1346	1370	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alas1	C	A	9: 106,243,375	A73S	probably benign	Het
Aldoart2	G	A	12: 55,565,419	R43Q	probably benign	Het
Ano4	T	C	10: 89,317,303	H49R	possibly damaging	Het
Atic	T	C	1: 71,564,507	S161P	probably damaging	Het
Atp6v1c2	T	C	12: 17,291,658	E244G	probably benign	Het
Cd164l2	C	A	4: 133,221,478	L42I	unknown	Het
Cdc42ep2	T	C	19: 5,918,210	R156G	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdk5	T	A	5: 24,419,461	N265I	probably benign	Het
Cfap69	G	T	5: 5,589,133	N262K	possibly damaging	Het
Chd6	C	T	2: 160,949,953	V2495M	probably damaging	Het
Cps1	T	A	1: 67,166,380	F521I	possibly damaging	Het
Crb2	A	G	2: 37,793,753	E1089G	probably benign	Het
Decr1	T	C	4: 15,929,795	D166G	probably damaging	Het
Dhodh	G	A	8: 109,606,343		probably benign	Het
Dnaaf5	G	A	5: 139,161,877	V399I	probably benign	Het
Dnah11	T	C	12: 118,157,361	T526A	probably benign	Het
Elfn2	T	A	15: 78,674,201	I49F	probably damaging	Het
Gabra1	T	C	11: 42,154,828	T152A	probably damaging	Het
Gigyf2	C	A	1: 87,365,266	T85K	probably damaging	Het
Gimap8	A	T	6: 48,651,083	Y258F	possibly damaging	Het
Glmn	A	G	5: 107,561,886	C351R	probably benign	Het
Gm10032	T	C	14: 66,792,549		noncoding transcript	Het
Gm340	T	C	19: 41,585,932	I1042T	probably damaging	Het
Gorasp2	G	A	2: 70,689,254	A328T	probably benign	Het
Grin1	A	T	2: 25,303,907	H392Q	probably benign	Het
Gzmn	A	G	14: 56,167,862	V55A	probably damaging	Het
Herc4	T	A	10: 63,289,097	S497T	probably benign	Het
Hrc	A	T	7: 45,336,091	D222V	probably damaging	Het
Iars2	T	C	1: 185,294,769	H761R	probably damaging	Het
Jmjd1c	T	A	10: 67,240,701	D2101E	possibly damaging	Het
Kcng1	C	T	2: 168,263,133	M264I	probably benign	Het
Klra14-ps	C	A	6: 130,157,683		noncoding transcript	Het
Krtap5-3	T	A	7: 142,202,237	C270*	probably null	Het
Lama3	A	G	18: 12,577,900	H3164R	probably damaging	Het
Mdn1	T	C	4: 32,741,418	M3840T	possibly damaging	Het
Mtor	A	T	4: 148,453,983	H166L	probably benign	Het
Mx1	T	C	16: 97,448,360	N556D	possibly damaging	Het
Oca2	A	T	7: 56,295,498	R285*	probably null	Het
Olfr103	T	A	17: 37,336,813	I140F	probably benign	Het
Olfr1285	T	C	2: 111,409,286		noncoding transcript	Het
Olfr521	A	G	7: 99,767,510	E116G	probably damaging	Het
Olfr681	G	A	7: 105,126,564	H246Y	probably damaging	Het
Olfr952	A	T	9: 39,426,623	Y149*	probably null	Het
Pan3	A	G	5: 147,455,105		probably null	Het
Pard3	G	A	8: 127,378,264	V496M	probably damaging	Het
Pdcd2l	A	T	7: 34,192,889	V185D	possibly damaging	Het
Pgghg	T	C	7: 140,946,564	V623A	possibly damaging	Het
Pigu	C	A	2: 155,335,329		probably benign	Het
Pkmyt1	G	A	17: 23,732,592	R40Q	probably benign	Het
Prag1	G	A	8: 36,099,889	A65T	probably benign	Het
Prkdc	C	A	16: 15,772,121	T2616N	possibly damaging	Het
Prpf8	G	A	11: 75,500,204	E1360K	probably benign	Het
Ptprt	C	T	2: 162,278,164	V128M	probably damaging	Het
Rp1l1	C	T	14: 64,030,013	S1016L	probably benign	Het
Rprd1a	G	T	18: 24,488,200	D307E	probably damaging	Het
Slc11a1	A	T	1: 74,383,777		probably benign	Het
Slc22a16	T	A	10: 40,581,390	M209K	probably damaging	Het
Slf2	T	G	19: 44,948,037	L707R	probably damaging	Het
Son	T	A	16: 91,656,675	M770K	probably damaging	Het
Taf6l	T	C	19: 8,778,053		probably benign	Het
Tbc1d2	C	A	4: 46,614,006	V692L	probably benign	Het
Tnpo3	C	T	6: 29,582,153		probably benign	Het
Txndc16	A	T	14: 45,211,140		probably benign	Het
Ubr1	T	C	2: 120,904,044	K1125R	probably benign	Het
Vmn2r9	A	G	5: 108,846,485	S433P	probably benign	Het
Zc3h12a	A	G	4: 125,126,913	S46P	probably benign	Het
Zwilch	T	G	9: 64,146,874	I490L	probably benign	Het

Other mutations in Drosha

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00576:Drosha	APN	15	12883194	missense	probably damaging	0.99
IGL00736:Drosha	APN	15	12833959	missense	unknown
IGL00963:Drosha	APN	15	12925997	missense	probably damaging	0.99
IGL01010:Drosha	APN	15	12827289	unclassified	probably benign
IGL01340:Drosha	APN	15	12834023	intron	probably benign
IGL01481:Drosha	APN	15	12842439	missense	probably benign
IGL01714:Drosha	APN	15	12878784	missense	probably damaging	1.00
IGL01721:Drosha	APN	15	12846112	nonsense	probably null
IGL01765:Drosha	APN	15	12902680	missense	probably damaging	1.00
IGL01893:Drosha	APN	15	12866650	splice site	probably benign
IGL01944:Drosha	APN	15	12889719	missense	probably damaging	1.00
IGL02285:Drosha	APN	15	12833864	missense	unknown
IGL02970:Drosha	APN	15	12913956	missense	probably damaging	0.98
IGL02990:Drosha	APN	15	12827267	unclassified	probably benign
IGL03019:Drosha	APN	15	12846099	missense	probably damaging	1.00
IGL03279:Drosha	APN	15	12859392	missense	probably benign	0.03
IGL03390:Drosha	APN	15	12884983	splice site	probably null
tippicanoe	UTSW	15	12859465	splice site	probably null
Tyler	UTSW	15	12861706	missense	probably benign	0.45
R0115:Drosha	UTSW	15	12846130	missense	probably benign	0.15
R0352:Drosha	UTSW	15	12837288	missense	unknown
R0401:Drosha	UTSW	15	12926031	nonsense	probably null
R0541:Drosha	UTSW	15	12907388	missense	probably benign	0.09
R0784:Drosha	UTSW	15	12867678	splice site	probably benign
R0918:Drosha	UTSW	15	12842533	critical splice donor site	probably null
R1473:Drosha	UTSW	15	12912520	missense	probably benign	0.04
R1503:Drosha	UTSW	15	12848073	missense	probably benign	0.02
R1526:Drosha	UTSW	15	12913984	missense	probably damaging	1.00
R1809:Drosha	UTSW	15	12890112	missense	probably null	1.00
R1859:Drosha	UTSW	15	12878718	missense	probably benign	0.14
R2004:Drosha	UTSW	15	12915381	missense	probably damaging	0.98
R2060:Drosha	UTSW	15	12924159	missense	possibly damaging	0.94
R2516:Drosha	UTSW	15	12859465	splice site	probably null
R3691:Drosha	UTSW	15	12834638	missense	unknown
R3784:Drosha	UTSW	15	12890529	missense	possibly damaging	0.82
R3789:Drosha	UTSW	15	12912537	nonsense	probably null
R3790:Drosha	UTSW	15	12912537	nonsense	probably null
R4020:Drosha	UTSW	15	12837336	missense	possibly damaging	0.96
R4817:Drosha	UTSW	15	12914047	missense	probably damaging	0.97
R4989:Drosha	UTSW	15	12935007	missense	probably benign	0.05
R5080:Drosha	UTSW	15	12842143	missense	probably benign	0.01
R5132:Drosha	UTSW	15	12837291	missense	unknown
R5386:Drosha	UTSW	15	12842121	missense	probably benign
R5457:Drosha	UTSW	15	12926029	missense	probably benign	0.26
R5536:Drosha	UTSW	15	12929711	missense	possibly damaging	0.58
R5800:Drosha	UTSW	15	12865067	missense	probably damaging	1.00
R5800:Drosha	UTSW	15	12902647	missense	probably damaging	1.00
R5915:Drosha	UTSW	15	12935066	missense	probably damaging	0.97
R5988:Drosha	UTSW	15	12834496	intron	probably benign
R6033:Drosha	UTSW	15	12925999	missense	probably benign	0.25
R6033:Drosha	UTSW	15	12925999	missense	probably benign	0.25
R6063:Drosha	UTSW	15	12834070	intron	probably benign
R6391:Drosha	UTSW	15	12889717	nonsense	probably null
R6492:Drosha	UTSW	15	12861706	missense	probably benign	0.45
R6799:Drosha	UTSW	15	12912537	nonsense	probably null
R6870:Drosha	UTSW	15	12907393	missense	probably benign	0.17
R6920:Drosha	UTSW	15	12834310	missense	unknown
R7101:Drosha	UTSW	15	12865067	missense	probably damaging	1.00
R7142:Drosha	UTSW	15	12924146	missense	possibly damaging	0.70
R7275:Drosha	UTSW	15	12846083	missense	possibly damaging	0.73
R7337:Drosha	UTSW	15	12846199	missense	possibly damaging	0.80
R7471:Drosha	UTSW	15	12889656	missense	probably damaging	1.00
R7538:Drosha	UTSW	15	12926243	missense	probably damaging	1.00
R7559:Drosha	UTSW	15	12842422	missense	probably damaging	0.96
R7651:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7652:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7653:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7727:Drosha	UTSW	15	12881645	missense	probably damaging	1.00
R7780:Drosha	UTSW	15	12848086	missense	probably benign	0.01
R8068:Drosha	UTSW	15	12883190	nonsense	probably null
R8283:Drosha	UTSW	15	12890501	missense	possibly damaging	0.47
R8523:Drosha	UTSW	15	12834322	missense	unknown
Z1177:Drosha	UTSW	15	12842092	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTCCGTGATGCTGAGTTAC -3'
(R):5'- GTGTTCACCCAAACAGACTGAC -3'

Sequencing Primer
(F):5'- CTTACAGTGAGCTCTGTTCCAGGAAG -3'
(R):5'- GACTGACTTTAACATTGCACTTACGC -3'

Posted On

2016-07-22