Incidental Mutation 'R5215:Prkdc'
ID403447
Institutional Source Beutler Lab
Gene Symbol Prkdc
Ensembl Gene ENSMUSG00000022672
Gene Nameprotein kinase, DNA activated, catalytic polypeptide
Synonymsslip, DOXNPH, DNA-PKcs, XRCC7, dxnph, DNA-PK, DNAPDcs
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location15637866-15842235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 15772121 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 2616 (T2616N)
Ref Sequence ENSEMBL: ENSMUSP00000023352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023352]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023352
AA Change: T2616N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023352
Gene: ENSMUSG00000022672
AA Change: T2616N

DomainStartEndE-ValueType
low complexity region 125 138 N/A INTRINSIC
low complexity region 1253 1263 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
NUC194 1810 2206 2.37e-246 SMART
SCOP:d1gw5a_ 2210 2493 5e-3 SMART
low complexity region 2669 2681 N/A INTRINSIC
low complexity region 2841 2855 N/A INTRINSIC
Pfam:FAT 3024 3470 8.2e-75 PFAM
PI3Kc 3749 4068 3.67e-86 SMART
FATC 4096 4128 1.57e-9 SMART
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of the DNA-dependent protein kinase (DNA-PK). It functions with the Ku70/Ku80 heterodimer protein in DNA double strand break repair and recombination. The protein encoded is a member of the PI3/PI4-kinase family.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mutations at this locus effect genome stability, radiation sensitivity and DNA repair. Nonsense (scid) and null homozygotes have severe combined immunodeficiency. A BALB/c variant allele reduces enzyme activity and predisposes to breast cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Prkdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Prkdc APN 16 15697226 missense probably damaging 1.00
IGL00225:Prkdc APN 16 15809644 missense possibly damaging 0.64
IGL00481:Prkdc APN 16 15790466 missense probably benign 0.41
IGL00488:Prkdc APN 16 15775847 splice site probably null
IGL00489:Prkdc APN 16 15799926 missense possibly damaging 0.51
IGL00579:Prkdc APN 16 15664239 missense probably damaging 1.00
IGL00587:Prkdc APN 16 15652358 splice site probably benign
IGL00666:Prkdc APN 16 15736835 missense probably damaging 1.00
IGL00675:Prkdc APN 16 15787158 missense probably benign 0.05
IGL00708:Prkdc APN 16 15779426 missense probably damaging 0.97
IGL00725:Prkdc APN 16 15816639 missense probably benign 0.10
IGL00818:Prkdc APN 16 15759754 missense possibly damaging 0.92
IGL00917:Prkdc APN 16 15739564 missense probably damaging 0.98
IGL00990:Prkdc APN 16 15702115 missense probably benign 0.03
IGL01126:Prkdc APN 16 15669321 missense probably benign 0.01
IGL01141:Prkdc APN 16 15726704 missense probably damaging 0.99
IGL01306:Prkdc APN 16 15667731 missense possibly damaging 0.67
IGL01326:Prkdc APN 16 15829692 missense probably benign
IGL01335:Prkdc APN 16 15816896 critical splice donor site probably null
IGL01419:Prkdc APN 16 15835166 missense probably damaging 1.00
IGL01434:Prkdc APN 16 15713587 missense probably benign 0.00
IGL01554:Prkdc APN 16 15652302 missense probably benign 0.05
IGL01671:Prkdc APN 16 15667745 missense possibly damaging 0.90
IGL01871:Prkdc APN 16 15783087 missense probably benign 0.00
IGL01874:Prkdc APN 16 15734994 missense possibly damaging 0.89
IGL01930:Prkdc APN 16 15698887 missense probably damaging 1.00
IGL01984:Prkdc APN 16 15708779 missense probably benign
IGL02121:Prkdc APN 16 15717184 missense probably benign 0.18
IGL02152:Prkdc APN 16 15669285 missense probably benign 0.15
IGL02172:Prkdc APN 16 15809759 missense probably benign 0.10
IGL02336:Prkdc APN 16 15785978 missense possibly damaging 0.47
IGL02336:Prkdc APN 16 15785979 missense probably benign 0.01
IGL02393:Prkdc APN 16 15816758 missense probably benign 0.42
IGL02406:Prkdc APN 16 15670535 missense probably benign 0.00
IGL02500:Prkdc APN 16 15714282 critical splice donor site probably null
IGL02568:Prkdc APN 16 15726542 missense probably damaging 0.98
IGL02579:Prkdc APN 16 15670601 missense possibly damaging 0.83
IGL02652:Prkdc APN 16 15783087 missense probably benign 0.00
IGL02661:Prkdc APN 16 15769825 missense possibly damaging 0.92
IGL02685:Prkdc APN 16 15836043 missense possibly damaging 0.61
IGL02741:Prkdc APN 16 15752726 splice site probably benign
IGL02803:Prkdc APN 16 15833666 splice site probably benign
IGL02866:Prkdc APN 16 15831327 missense probably damaging 1.00
IGL02882:Prkdc APN 16 15651519 nonsense probably null
IGL02989:Prkdc APN 16 15800016 missense possibly damaging 0.67
IGL03053:Prkdc APN 16 15834166 missense probably benign 0.02
IGL03071:Prkdc APN 16 15799984 missense probably benign 0.01
IGL03091:Prkdc APN 16 15705310 splice site probably benign
IGL03100:Prkdc APN 16 15713635 missense probably benign 0.08
IGL03128:Prkdc APN 16 15700744 splice site probably benign
IGL03168:Prkdc APN 16 15834166 missense probably benign 0.02
IGL03204:Prkdc APN 16 15769801 missense probably benign 0.01
IGL03390:Prkdc APN 16 15670626 nonsense probably null
anhimid UTSW 16 15725461 critical splice donor site probably null
Bushtit UTSW 16 15752764 missense probably damaging 0.97
clover UTSW 16 15702157 splice site probably benign
crackle UTSW 16 15786050 critical splice donor site probably null
daffy UTSW 16 15829697 missense possibly damaging 0.86
Elmer_fudd UTSW 16 15808058 missense probably benign 0.01
hobgoblin UTSW 16 15815986 missense probably damaging 1.00
liming UTSW 16 15752829 nonsense probably null
Schreier UTSW 16 15670528 missense probably benign 0.00
screamer UTSW 16 15831282 nonsense probably null
screamer10 UTSW 16 15768025 missense probably damaging 0.98
screamer2 UTSW 16 15652552 critical splice donor site probably null
screamer3 UTSW 16 15740332 critical splice donor site probably null
screamer4 UTSW 16 15783079 missense probably benign 0.00
screamer5 UTSW 16 15687404 missense probably benign
screamer6 UTSW 16 15759605 missense probably damaging 1.00
screamer7 UTSW 16 15654817 splice site probably null
Screamer8 UTSW 16 15719433 missense probably benign 0.00
Screamer9 UTSW 16 15734922 missense probably benign 0.01
Tweetie UTSW 16 15717801 missense probably damaging 1.00
updock UTSW 16 15795094 missense probably benign
ANU23:Prkdc UTSW 16 15667731 missense possibly damaging 0.67
R0008:Prkdc UTSW 16 15708701 splice site probably benign
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0069:Prkdc UTSW 16 15726504 missense probably benign 0.03
R0125:Prkdc UTSW 16 15699007 missense probably damaging 0.98
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0132:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0137:Prkdc UTSW 16 15740332 critical splice donor site probably null
R0334:Prkdc UTSW 16 15736799 missense probably benign 0.00
R0373:Prkdc UTSW 16 15791927 missense probably damaging 1.00
R0485:Prkdc UTSW 16 15833740 missense probably damaging 0.97
R0511:Prkdc UTSW 16 15831282 nonsense probably null
R0538:Prkdc UTSW 16 15833788 missense probably damaging 1.00
R0595:Prkdc UTSW 16 15808088 missense probably damaging 1.00
R0607:Prkdc UTSW 16 15772057 missense probably damaging 0.98
R0616:Prkdc UTSW 16 15690407 missense probably damaging 1.00
R0630:Prkdc UTSW 16 15810801 missense probably damaging 1.00
R0694:Prkdc UTSW 16 15768637 missense probably damaging 1.00
R0702:Prkdc UTSW 16 15785971 missense possibly damaging 0.95
R0965:Prkdc UTSW 16 15829716 missense probably benign
R1027:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R1029:Prkdc UTSW 16 15654749 splice site probably benign
R1033:Prkdc UTSW 16 15767951 missense probably damaging 1.00
R1067:Prkdc UTSW 16 15752782 missense probably damaging 0.99
R1116:Prkdc UTSW 16 15783079 missense probably benign 0.00
R1187:Prkdc UTSW 16 15759746 missense probably damaging 0.98
R1226:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R1279:Prkdc UTSW 16 15690282 missense probably damaging 1.00
R1304:Prkdc UTSW 16 15759723 missense probably damaging 0.99
R1314:Prkdc UTSW 16 15664227 missense possibly damaging 0.68
R1351:Prkdc UTSW 16 15667700 missense possibly damaging 0.62
R1509:Prkdc UTSW 16 15731566 missense probably damaging 1.00
R1512:Prkdc UTSW 16 15687404 missense probably benign
R1531:Prkdc UTSW 16 15772106 missense probably benign 0.01
R1579:Prkdc UTSW 16 15675328 missense probably benign 0.00
R1669:Prkdc UTSW 16 15734058 missense probably damaging 1.00
R1682:Prkdc UTSW 16 15676989 missense probably benign 0.19
R1713:Prkdc UTSW 16 15795094 missense probably benign
R1762:Prkdc UTSW 16 15637961 missense probably benign
R1789:Prkdc UTSW 16 15739524 missense probably damaging 1.00
R1822:Prkdc UTSW 16 15759605 missense probably damaging 1.00
R1848:Prkdc UTSW 16 15808058 missense probably benign 0.01
R1887:Prkdc UTSW 16 15829635 missense probably benign 0.00
R1891:Prkdc UTSW 16 15725436 missense probably benign 0.02
R1921:Prkdc UTSW 16 15714215 missense possibly damaging 0.80
R1922:Prkdc UTSW 16 15714266 missense probably benign 0.00
R1929:Prkdc UTSW 16 15654817 splice site probably null
R1939:Prkdc UTSW 16 15835913 missense possibly damaging 0.95
R2021:Prkdc UTSW 16 15677009 missense probably benign 0.00
R2033:Prkdc UTSW 16 15687352 splice site probably benign
R2056:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2057:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2058:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2082:Prkdc UTSW 16 15715963 missense probably damaging 1.00
R2109:Prkdc UTSW 16 15687390 missense probably benign 0.01
R2124:Prkdc UTSW 16 15719433 missense probably benign 0.00
R2164:Prkdc UTSW 16 15705207 missense probably damaging 1.00
R2174:Prkdc UTSW 16 15734922 missense probably benign 0.01
R2191:Prkdc UTSW 16 15698824 missense probably damaging 1.00
R2270:Prkdc UTSW 16 15654817 splice site probably null
R2271:Prkdc UTSW 16 15654817 splice site probably null
R2272:Prkdc UTSW 16 15654817 splice site probably null
R2356:Prkdc UTSW 16 15684204 missense probably benign
R2852:Prkdc UTSW 16 15652552 critical splice donor site probably null
R3115:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3116:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3499:Prkdc UTSW 16 15768025 missense probably damaging 0.98
R3687:Prkdc UTSW 16 15799967 missense probably benign
R3834:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3835:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3961:Prkdc UTSW 16 15829611 splice site probably null
R4151:Prkdc UTSW 16 15816773 missense probably benign
R4233:Prkdc UTSW 16 15835919 missense probably benign 0.11
R4281:Prkdc UTSW 16 15806099 splice site probably null
R4296:Prkdc UTSW 16 15737905 missense probably damaging 0.99
R4344:Prkdc UTSW 16 15768022 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15773739 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15836082 missense probably damaging 1.00
R4497:Prkdc UTSW 16 15700653 missense probably benign 0.43
R4549:Prkdc UTSW 16 15736870 missense possibly damaging 0.89
R4594:Prkdc UTSW 16 15767966 missense possibly damaging 0.64
R4603:Prkdc UTSW 16 15810824 missense probably damaging 0.98
R4615:Prkdc UTSW 16 15663074 missense probably damaging 0.99
R4648:Prkdc UTSW 16 15816774 missense probably benign 0.05
R4662:Prkdc UTSW 16 15734052 missense probably damaging 1.00
R4680:Prkdc UTSW 16 15772030 missense probably benign 0.00
R4700:Prkdc UTSW 16 15702112 missense probably damaging 1.00
R4716:Prkdc UTSW 16 15810837 missense probably benign 0.32
R4720:Prkdc UTSW 16 15667715 missense probably benign
R4785:Prkdc UTSW 16 15648976 missense probably benign 0.21
R4822:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R4829:Prkdc UTSW 16 15702075 missense possibly damaging 0.80
R4981:Prkdc UTSW 16 15678309 missense probably damaging 1.00
R4989:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R5059:Prkdc UTSW 16 15838018 missense probably damaging 1.00
R5074:Prkdc UTSW 16 15772048 missense probably damaging 1.00
R5115:Prkdc UTSW 16 15790580 missense probably benign
R5151:Prkdc UTSW 16 15716035 missense probably damaging 1.00
R5165:Prkdc UTSW 16 15678272 missense probably damaging 1.00
R5270:Prkdc UTSW 16 15734955 missense probably damaging 1.00
R5278:Prkdc UTSW 16 15714974 missense probably damaging 1.00
R5351:Prkdc UTSW 16 15831312 missense probably benign 0.03
R5416:Prkdc UTSW 16 15805950 missense probably damaging 1.00
R5418:Prkdc UTSW 16 15795097 missense probably benign 0.20
R5437:Prkdc UTSW 16 15769875 missense possibly damaging 0.46
R5452:Prkdc UTSW 16 15768637 missense possibly damaging 0.96
R5518:Prkdc UTSW 16 15678308 missense probably damaging 1.00
R5538:Prkdc UTSW 16 15651469 missense probably damaging 1.00
R5589:Prkdc UTSW 16 15706791 missense probably benign 0.02
R5618:Prkdc UTSW 16 15809612 missense probably damaging 1.00
R5640:Prkdc UTSW 16 15829769 missense possibly damaging 0.86
R5661:Prkdc UTSW 16 15810770 missense possibly damaging 0.81
R5771:Prkdc UTSW 16 15664233 missense probably damaging 1.00
R5772:Prkdc UTSW 16 15779388 missense possibly damaging 0.49
R5783:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R5792:Prkdc UTSW 16 15816752 missense probably damaging 1.00
R5797:Prkdc UTSW 16 15737834 nonsense probably null
R5826:Prkdc UTSW 16 15734098 missense probably benign
R5883:Prkdc UTSW 16 15715914 missense probably benign
R5895:Prkdc UTSW 16 15752829 nonsense probably null
R5998:Prkdc UTSW 16 15783157 missense probably damaging 1.00
R6000:Prkdc UTSW 16 15829697 missense possibly damaging 0.86
R6120:Prkdc UTSW 16 15739471 missense probably benign 0.00
R6145:Prkdc UTSW 16 15772073 missense probably damaging 1.00
R6209:Prkdc UTSW 16 15790592 missense probably damaging 1.00
R6293:Prkdc UTSW 16 15787155 missense probably benign 0.00
R6321:Prkdc UTSW 16 15714919 missense probably benign
R6376:Prkdc UTSW 16 15769885 missense probably benign 0.06
R6387:Prkdc UTSW 16 15698815 missense probably benign 0.01
R6406:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R6469:Prkdc UTSW 16 15795075 missense probably benign 0.10
R6486:Prkdc UTSW 16 15752764 missense probably damaging 0.97
R6665:Prkdc UTSW 16 15786050 critical splice donor site probably null
R6703:Prkdc UTSW 16 15670528 missense probably benign 0.00
R6774:Prkdc UTSW 16 15725461 critical splice donor site probably null
R6854:Prkdc UTSW 16 15651538 missense probably damaging 1.00
R6878:Prkdc UTSW 16 15777072 missense probably benign 0.31
R6882:Prkdc UTSW 16 15783263 critical splice donor site probably null
R6882:Prkdc UTSW 16 15808156 missense probably benign 0.33
R6949:Prkdc UTSW 16 15799989 missense probably benign
R6950:Prkdc UTSW 16 15815986 missense probably damaging 1.00
R7019:Prkdc UTSW 16 15769966 missense probably benign 0.00
R7064:Prkdc UTSW 16 15790453 missense probably benign 0.00
R7097:Prkdc UTSW 16 15689343 missense probably damaging 1.00
R7201:Prkdc UTSW 16 15698803 missense probably benign 0.12
R7235:Prkdc UTSW 16 15714263 missense probably benign
R7283:Prkdc UTSW 16 15717764 missense probably benign 0.00
R7401:Prkdc UTSW 16 15648738 missense probably damaging 1.00
R7525:Prkdc UTSW 16 15672327 missense probably damaging 1.00
R7647:Prkdc UTSW 16 15737943 missense probably damaging 1.00
R7679:Prkdc UTSW 16 15831319 missense probably damaging 1.00
R7803:Prkdc UTSW 16 15806096 missense probably null 0.05
R7858:Prkdc UTSW 16 15689277 missense probably benign 0.11
R7872:Prkdc UTSW 16 15715006 missense probably benign 0.05
R7896:Prkdc UTSW 16 15708903 missense probably damaging 0.97
R7941:Prkdc UTSW 16 15689277 missense probably benign 0.11
R7955:Prkdc UTSW 16 15715006 missense probably benign 0.05
R7979:Prkdc UTSW 16 15708903 missense probably damaging 0.97
R8032:Prkdc UTSW 16 15779451 missense probably benign 0.00
R8055:Prkdc UTSW 16 15816885 missense probably benign 0.09
X0023:Prkdc UTSW 16 15740278 missense probably benign
Z1176:Prkdc UTSW 16 15687422 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCATACACTAATGGTACTATTGG -3'
(R):5'- CCAAGCATGTCTAGCTACAGTCAG -3'

Sequencing Primer
(F):5'- GCTTGAAATTGAACTTAGAGCCTCAC -3'
(R):5'- TGCTTTCGCAAAGACTACTCAG -3'
Posted On2016-07-22