Mutagenetix > Incidental Mutations

Incidental Mutation 'R5215:Rp1l1'

403443

Institutional Source

Beutler Lab

Gene Symbol

Rp1l1

Ensembl Gene

ENSMUSG00000046049

Gene Name

retinitis pigmentosa 1 homolog like 1

Synonyms

Dcdc4, Rp1hl1

MMRRC Submission

042788-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R5215 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63992506-64035025 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 64030013 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 1016 (S1016L)

Ref Sequence

ENSEMBL: ENSMUSP00000055449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058229]

Predicted Effect

probably benign
Transcript: ENSMUST00000058229
AA Change: S1016L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: S1016L

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
DCX	37	121	1.58e-13	SMART
DCX	155	239	1e-15	SMART
low complexity region	709	728	N/A	INTRINSIC
low complexity region	870	884	N/A	INTRINSIC
low complexity region	1159	1177	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1612	1618	N/A	INTRINSIC
low complexity region	1642	1652	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224314

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alas1	C	A	9: 106,243,375	A73S	probably benign	Het
Aldoart2	G	A	12: 55,565,419	R43Q	probably benign	Het
Ano4	T	C	10: 89,317,303	H49R	possibly damaging	Het
Atic	T	C	1: 71,564,507	S161P	probably damaging	Het
Atp6v1c2	T	C	12: 17,291,658	E244G	probably benign	Het
Cd164l2	C	A	4: 133,221,478	L42I	unknown	Het
Cdc42ep2	T	C	19: 5,918,210	R156G	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdk5	T	A	5: 24,419,461	N265I	probably benign	Het
Cfap69	G	T	5: 5,589,133	N262K	possibly damaging	Het
Chd6	C	T	2: 160,949,953	V2495M	probably damaging	Het
Cps1	T	A	1: 67,166,380	F521I	possibly damaging	Het
Crb2	A	G	2: 37,793,753	E1089G	probably benign	Het
Decr1	T	C	4: 15,929,795	D166G	probably damaging	Het
Dhodh	G	A	8: 109,606,343		probably benign	Het
Dnaaf5	G	A	5: 139,161,877	V399I	probably benign	Het
Dnah11	T	C	12: 118,157,361	T526A	probably benign	Het
Drosha	T	C	15: 12,885,133		probably benign	Het
Elfn2	T	A	15: 78,674,201	I49F	probably damaging	Het
Gabra1	T	C	11: 42,154,828	T152A	probably damaging	Het
Gigyf2	C	A	1: 87,365,266	T85K	probably damaging	Het
Gimap8	A	T	6: 48,651,083	Y258F	possibly damaging	Het
Glmn	A	G	5: 107,561,886	C351R	probably benign	Het
Gm10032	T	C	14: 66,792,549		noncoding transcript	Het
Gm340	T	C	19: 41,585,932	I1042T	probably damaging	Het
Gorasp2	G	A	2: 70,689,254	A328T	probably benign	Het
Grin1	A	T	2: 25,303,907	H392Q	probably benign	Het
Gzmn	A	G	14: 56,167,862	V55A	probably damaging	Het
Herc4	T	A	10: 63,289,097	S497T	probably benign	Het
Hrc	A	T	7: 45,336,091	D222V	probably damaging	Het
Iars2	T	C	1: 185,294,769	H761R	probably damaging	Het
Jmjd1c	T	A	10: 67,240,701	D2101E	possibly damaging	Het
Kcng1	C	T	2: 168,263,133	M264I	probably benign	Het
Klra14-ps	C	A	6: 130,157,683		noncoding transcript	Het
Krtap5-3	T	A	7: 142,202,237	C270*	probably null	Het
Lama3	A	G	18: 12,577,900	H3164R	probably damaging	Het
Mdn1	T	C	4: 32,741,418	M3840T	possibly damaging	Het
Mtor	A	T	4: 148,453,983	H166L	probably benign	Het
Mx1	T	C	16: 97,448,360	N556D	possibly damaging	Het
Oca2	A	T	7: 56,295,498	R285*	probably null	Het
Olfr103	T	A	17: 37,336,813	I140F	probably benign	Het
Olfr1285	T	C	2: 111,409,286		noncoding transcript	Het
Olfr521	A	G	7: 99,767,510	E116G	probably damaging	Het
Olfr681	G	A	7: 105,126,564	H246Y	probably damaging	Het
Olfr952	A	T	9: 39,426,623	Y149*	probably null	Het
Pan3	A	G	5: 147,455,105		probably null	Het
Pard3	G	A	8: 127,378,264	V496M	probably damaging	Het
Pdcd2l	A	T	7: 34,192,889	V185D	possibly damaging	Het
Pgghg	T	C	7: 140,946,564	V623A	possibly damaging	Het
Pigu	C	A	2: 155,335,329		probably benign	Het
Pkmyt1	G	A	17: 23,732,592	R40Q	probably benign	Het
Prag1	G	A	8: 36,099,889	A65T	probably benign	Het
Prkdc	C	A	16: 15,772,121	T2616N	possibly damaging	Het
Prpf8	G	A	11: 75,500,204	E1360K	probably benign	Het
Ptprt	C	T	2: 162,278,164	V128M	probably damaging	Het
Rprd1a	G	T	18: 24,488,200	D307E	probably damaging	Het
Slc11a1	A	T	1: 74,383,777		probably benign	Het
Slc22a16	T	A	10: 40,581,390	M209K	probably damaging	Het
Slf2	T	G	19: 44,948,037	L707R	probably damaging	Het
Son	T	A	16: 91,656,675	M770K	probably damaging	Het
Taf6l	T	C	19: 8,778,053		probably benign	Het
Tbc1d2	C	A	4: 46,614,006	V692L	probably benign	Het
Tnpo3	C	T	6: 29,582,153		probably benign	Het
Txndc16	A	T	14: 45,211,140		probably benign	Het
Ubr1	T	C	2: 120,904,044	K1125R	probably benign	Het
Vmn2r9	A	G	5: 108,846,485	S433P	probably benign	Het
Zc3h12a	A	G	4: 125,126,913	S46P	probably benign	Het
Zwilch	T	G	9: 64,146,874	I490L	probably benign	Het

Other mutations in Rp1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Rp1l1	APN	14	64028725	missense	probably benign	0.01
IGL02063:Rp1l1	APN	14	64029536	missense	probably damaging	0.99
IGL02132:Rp1l1	APN	14	64028810	missense	probably benign
IGL02430:Rp1l1	APN	14	64029286	missense	probably benign	0.00
IGL02977:Rp1l1	APN	14	64028150	missense	probably benign	0.01
IGL03213:Rp1l1	APN	14	64028415	missense	probably damaging	0.98
IGL03346:Rp1l1	APN	14	64029440	missense	probably benign
R0085:Rp1l1	UTSW	14	64022295	missense	probably damaging	0.99
R0347:Rp1l1	UTSW	14	64030804	nonsense	probably null
R0362:Rp1l1	UTSW	14	64031066	nonsense	probably null
R0369:Rp1l1	UTSW	14	64029388	missense	possibly damaging	0.84
R0538:Rp1l1	UTSW	14	64022092	missense	probably damaging	1.00
R0544:Rp1l1	UTSW	14	64032066	missense	probably benign	0.00
R0780:Rp1l1	UTSW	14	64030351	missense	possibly damaging	0.94
R0944:Rp1l1	UTSW	14	64032232	missense	probably benign	0.05
R1051:Rp1l1	UTSW	14	64032535	missense	probably damaging	0.99
R1126:Rp1l1	UTSW	14	64030469	missense	probably damaging	1.00
R1450:Rp1l1	UTSW	14	64028150	missense	probably benign	0.01
R1483:Rp1l1	UTSW	14	64029047	missense	possibly damaging	0.76
R1508:Rp1l1	UTSW	14	64030892	missense	possibly damaging	0.83
R1553:Rp1l1	UTSW	14	64031894	missense	probably benign	0.00
R1651:Rp1l1	UTSW	14	64030993	missense	probably damaging	0.97
R1682:Rp1l1	UTSW	14	64028968	missense	probably damaging	0.98
R1809:Rp1l1	UTSW	14	64027966	missense	probably benign	0.18
R1885:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1887:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1898:Rp1l1	UTSW	14	64031590	missense	probably benign	0.04
R1924:Rp1l1	UTSW	14	64031543	missense	probably benign
R1939:Rp1l1	UTSW	14	64029593	missense	probably benign
R1941:Rp1l1	UTSW	14	64022252	missense	probably damaging	1.00
R2129:Rp1l1	UTSW	14	64028966	missense	possibly damaging	0.93
R2363:Rp1l1	UTSW	14	64029998	missense	possibly damaging	0.55
R3894:Rp1l1	UTSW	14	64029307	missense	probably benign
R3974:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3975:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3976:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R4072:Rp1l1	UTSW	14	64028132	missense	probably damaging	1.00
R4672:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4673:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4749:Rp1l1	UTSW	14	64029800	missense	probably damaging	0.99
R4755:Rp1l1	UTSW	14	64030070	missense	probably benign	0.34
R4877:Rp1l1	UTSW	14	64026171	missense	probably benign	0.00
R4930:Rp1l1	UTSW	14	64032206	missense	probably benign
R5039:Rp1l1	UTSW	14	64031356	missense	probably benign	0.21
R5106:Rp1l1	UTSW	14	64027946	missense	probably damaging	1.00
R5184:Rp1l1	UTSW	14	64030180	missense	probably damaging	1.00
R5409:Rp1l1	UTSW	14	64030621	missense	probably benign	0.02
R5575:Rp1l1	UTSW	14	64030984	missense	probably benign	0.23
R5696:Rp1l1	UTSW	14	64029746	missense	probably damaging	0.99
R5739:Rp1l1	UTSW	14	64032170	missense	probably benign	0.01
R5878:Rp1l1	UTSW	14	64028906	missense	probably benign	0.09
R6133:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6134:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6135:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6428:Rp1l1	UTSW	14	64032389	missense	possibly damaging	0.92
R6594:Rp1l1	UTSW	14	64031677	nonsense	probably null
R6736:Rp1l1	UTSW	14	64029724	missense	possibly damaging	0.93
R6800:Rp1l1	UTSW	14	64031150	missense	possibly damaging	0.92
R6848:Rp1l1	UTSW	14	64028218	missense	possibly damaging	0.79
R6878:Rp1l1	UTSW	14	64031852	missense	probably benign	0.00
R6922:Rp1l1	UTSW	14	64030385	missense	possibly damaging	0.93
R6980:Rp1l1	UTSW	14	64028720	missense	probably benign	0.02
R7053:Rp1l1	UTSW	14	64031509	missense	possibly damaging	0.68
R7151:Rp1l1	UTSW	14	64029026	missense	possibly damaging	0.73
R7291:Rp1l1	UTSW	14	64032298	missense	probably benign	0.10
R7335:Rp1l1	UTSW	14	64031998	missense	probably benign	0.00
R7344:Rp1l1	UTSW	14	64029620	missense	probably benign	0.00
R7470:Rp1l1	UTSW	14	64028566	missense	probably benign
R7570:Rp1l1	UTSW	14	64031574	nonsense	probably null
R7585:Rp1l1	UTSW	14	64030139	missense	probably damaging	0.96
R7591:Rp1l1	UTSW	14	64026109	missense	probably damaging	1.00
R7667:Rp1l1	UTSW	14	64029803	missense	probably benign	0.04
R7862:Rp1l1	UTSW	14	64028027	missense	probably damaging	1.00
R7935:Rp1l1	UTSW	14	64031225	missense	probably damaging	0.99
R8256:Rp1l1	UTSW	14	64028153	missense	probably benign	0.18
R8403:Rp1l1	UTSW	14	64028809	missense	probably benign	0.21
X0057:Rp1l1	UTSW	14	64030040	missense	probably benign	0.14
X0063:Rp1l1	UTSW	14	64029223	missense	probably damaging	0.98
Z1088:Rp1l1	UTSW	14	64028758	missense	possibly damaging	0.80
Z1088:Rp1l1	UTSW	14	64030378	missense	probably benign	0.01
Z1176:Rp1l1	UTSW	14	64029144	missense	probably damaging	1.00
Z1177:Rp1l1	UTSW	14	64032297	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGCCGGTACTCATGACGTATG -3'
(R):5'- TAGAGACCTCTGGTAGACTGC -3'

Sequencing Primer
(F):5'- CACAGAGGTGCCCAGTGATG -3'
(R):5'- CTCTGGTAGACTGCTGGGC -3'

Posted On

2016-07-22