Incidental Mutation 'R5302:Mcm10'
List |< first << previous [record 23 of 42] next >> last >|
ID404283
Institutional Source Beutler Lab
Gene Symbol Mcm10
Ensembl Gene ENSMUSG00000026669
Gene Nameminichromosome maintenance 10 replication initiation factor
SynonymsC330019M07Rik, 2410041F14Rik
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location4989714-5012791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5007370 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 135 (I135V)
Ref Sequence ENSEMBL: ENSMUSP00000100050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027980] [ENSMUST00000102985]
Predicted Effect probably benign
Transcript: ENSMUST00000027980
AA Change: I135V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027980
Gene: ENSMUSG00000026669
AA Change: I135V

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 2e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102985
AA Change: I135V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100050
Gene: ENSMUSG00000026669
AA Change: I135V

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 3.7e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146257
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryonic cell proliferation and early embryonic letahlity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Mcm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Mcm10 APN 2 5008628 missense probably benign 0.00
IGL02028:Mcm10 APN 2 5008700 missense possibly damaging 0.95
IGL02672:Mcm10 APN 2 5001281 missense probably benign 0.00
IGL03352:Mcm10 APN 2 4994596 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0320:Mcm10 UTSW 2 5004086 missense probably benign
R0379:Mcm10 UTSW 2 5008623 missense probably benign 0.05
R0385:Mcm10 UTSW 2 5004154 missense possibly damaging 0.82
R0519:Mcm10 UTSW 2 5008545 missense probably benign
R1537:Mcm10 UTSW 2 4998780 missense possibly damaging 0.77
R1597:Mcm10 UTSW 2 4998752 missense probably damaging 1.00
R1727:Mcm10 UTSW 2 5006525 missense probably benign 0.10
R1758:Mcm10 UTSW 2 5004050 missense probably damaging 1.00
R1997:Mcm10 UTSW 2 4993760 missense probably damaging 1.00
R3618:Mcm10 UTSW 2 4997102 critical splice donor site probably null
R4005:Mcm10 UTSW 2 5001003 missense probably damaging 1.00
R4870:Mcm10 UTSW 2 5004159 missense probably damaging 1.00
R5488:Mcm10 UTSW 2 4992118 missense probably damaging 1.00
R6921:Mcm10 UTSW 2 5000935 missense probably benign 0.00
R7259:Mcm10 UTSW 2 5006517 missense probably benign 0.02
R7353:Mcm10 UTSW 2 5007109 missense possibly damaging 0.54
R7489:Mcm10 UTSW 2 5001301 missense probably damaging 1.00
R7744:Mcm10 UTSW 2 4991442 missense probably damaging 1.00
R7903:Mcm10 UTSW 2 4995802 missense probably benign 0.00
X0020:Mcm10 UTSW 2 5007148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGAGATGAATCTTCCCG -3'
(R):5'- TCAGGTGTCAAAAGGTTGATTGC -3'

Sequencing Primer
(F):5'- GAGATGAATCTTCCCGATTGAAAATG -3'
(R):5'- GGTTTCTTAAGGAACCTCTCTGAAG -3'
Posted On2016-07-22