Incidental Mutation 'R5302:Mcm10'
ID 404283
Institutional Source Beutler Lab
Gene Symbol Mcm10
Ensembl Gene ENSMUSG00000026669
Gene Name minichromosome maintenance 10 replication initiation factor
Synonyms C330019M07Rik, 2410041F14Rik
MMRRC Submission 042885-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5302 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 4995535-5017602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5012181 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 135 (I135V)
Ref Sequence ENSEMBL: ENSMUSP00000100050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027980] [ENSMUST00000102985]
AlphaFold Q0VBD2
Predicted Effect probably benign
Transcript: ENSMUST00000027980
AA Change: I135V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027980
Gene: ENSMUSG00000026669
AA Change: I135V

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 2e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102985
AA Change: I135V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100050
Gene: ENSMUSG00000026669
AA Change: I135V

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 3.7e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146257
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryonic cell proliferation and early embryonic letahlity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,323,111 (GRCm39) V1657A possibly damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Acot5 A G 12: 84,120,215 (GRCm39) Y190C probably damaging Het
Ascc3 T A 10: 50,583,873 (GRCm39) Y941N probably benign Het
BC035947 A T 1: 78,488,599 (GRCm39) M1K probably null Het
C2cd5 A G 6: 143,019,482 (GRCm39) C278R probably benign Het
Cd200r1 G T 16: 44,613,172 (GRCm39) L259F possibly damaging Het
Clcn4 A G 7: 7,297,050 (GRCm39) V136A possibly damaging Het
Cntnap5a T C 1: 116,085,300 (GRCm39) S413P probably benign Het
Corin T A 5: 72,473,441 (GRCm39) E748D probably benign Het
Crtc2 G T 3: 90,168,325 (GRCm39) G356V probably damaging Het
D1Pas1 T A 1: 186,701,642 (GRCm39) Y524N probably damaging Het
Dlgap4 T C 2: 156,602,818 (GRCm39) S147P probably damaging Het
Eif1ad16 T A 12: 87,985,316 (GRCm39) I76F probably damaging Het
Enpp1 A T 10: 24,527,288 (GRCm39) I633N probably benign Het
Gm3095 A G 14: 15,170,367 (GRCm39) D72G probably null Het
Gm5449 C T 13: 53,679,787 (GRCm39) noncoding transcript Het
Gpx7 T C 4: 108,258,111 (GRCm39) T161A probably benign Het
Grip1 T C 10: 119,855,982 (GRCm39) L236P probably damaging Het
H2-Q2 G T 17: 35,563,885 (GRCm39) R255S probably damaging Het
Il17rc G T 6: 113,459,997 (GRCm39) A648S possibly damaging Het
Klhl12 A G 1: 134,417,189 (GRCm39) E540G possibly damaging Het
Mrps26 C A 2: 130,406,087 (GRCm39) T100K probably benign Het
Nid2 A G 14: 19,829,769 (GRCm39) T687A probably benign Het
Npas3 A T 12: 54,115,619 (GRCm39) D829V probably damaging Het
Ocln T C 13: 100,642,807 (GRCm39) D176G probably damaging Het
Or11h6 A G 14: 50,879,776 (GRCm39) probably null Het
Pax3 A C 1: 78,098,249 (GRCm39) M380R possibly damaging Het
Pcdha3 A G 18: 37,081,208 (GRCm39) E650G probably damaging Het
Pdcd11 C A 19: 47,096,083 (GRCm39) H668N probably damaging Het
Polr3b T C 10: 84,535,264 (GRCm39) Y858H possibly damaging Het
Pus10 T C 11: 23,617,416 (GRCm39) probably null Het
Raver1 T C 9: 20,986,677 (GRCm39) D739G probably damaging Het
Skic3 G A 13: 76,295,886 (GRCm39) E1050K possibly damaging Het
Slc26a11 T C 11: 119,254,276 (GRCm39) L198P probably damaging Het
Slc44a3 A G 3: 121,303,962 (GRCm39) V258A probably damaging Het
Socs7 T A 11: 97,280,025 (GRCm39) I524N probably damaging Het
Steap4 T A 5: 8,025,547 (GRCm39) L36* probably null Het
Svep1 G C 4: 58,096,183 (GRCm39) T1479S possibly damaging Het
Ttn C A 2: 76,547,619 (GRCm39) V32184F probably damaging Het
Vmn1r22 T C 6: 57,877,960 (GRCm39) N6D possibly damaging Het
Other mutations in Mcm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Mcm10 APN 2 5,013,439 (GRCm39) missense probably benign 0.00
IGL02028:Mcm10 APN 2 5,013,511 (GRCm39) missense possibly damaging 0.95
IGL02672:Mcm10 APN 2 5,006,092 (GRCm39) missense probably benign 0.00
IGL03352:Mcm10 APN 2 4,999,407 (GRCm39) missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4,996,218 (GRCm39) missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4,996,218 (GRCm39) missense probably damaging 1.00
R0320:Mcm10 UTSW 2 5,008,897 (GRCm39) missense probably benign
R0379:Mcm10 UTSW 2 5,013,434 (GRCm39) missense probably benign 0.05
R0385:Mcm10 UTSW 2 5,008,965 (GRCm39) missense possibly damaging 0.82
R0519:Mcm10 UTSW 2 5,013,356 (GRCm39) missense probably benign
R1537:Mcm10 UTSW 2 5,003,591 (GRCm39) missense possibly damaging 0.77
R1597:Mcm10 UTSW 2 5,003,563 (GRCm39) missense probably damaging 1.00
R1727:Mcm10 UTSW 2 5,011,336 (GRCm39) missense probably benign 0.10
R1758:Mcm10 UTSW 2 5,008,861 (GRCm39) missense probably damaging 1.00
R1997:Mcm10 UTSW 2 4,998,571 (GRCm39) missense probably damaging 1.00
R3618:Mcm10 UTSW 2 5,001,913 (GRCm39) critical splice donor site probably null
R4005:Mcm10 UTSW 2 5,005,814 (GRCm39) missense probably damaging 1.00
R4870:Mcm10 UTSW 2 5,008,970 (GRCm39) missense probably damaging 1.00
R5488:Mcm10 UTSW 2 4,996,929 (GRCm39) missense probably damaging 1.00
R6921:Mcm10 UTSW 2 5,005,746 (GRCm39) missense probably benign 0.00
R7259:Mcm10 UTSW 2 5,011,328 (GRCm39) missense probably benign 0.02
R7353:Mcm10 UTSW 2 5,011,920 (GRCm39) missense possibly damaging 0.54
R7489:Mcm10 UTSW 2 5,006,112 (GRCm39) missense probably damaging 1.00
R7744:Mcm10 UTSW 2 4,996,253 (GRCm39) missense probably damaging 1.00
R7903:Mcm10 UTSW 2 5,000,613 (GRCm39) missense probably benign 0.00
R9021:Mcm10 UTSW 2 4,997,782 (GRCm39) missense probably benign 0.03
R9072:Mcm10 UTSW 2 5,013,414 (GRCm39) missense possibly damaging 0.63
R9073:Mcm10 UTSW 2 5,013,414 (GRCm39) missense possibly damaging 0.63
R9135:Mcm10 UTSW 2 5,011,372 (GRCm39) missense probably benign 0.01
X0020:Mcm10 UTSW 2 5,011,959 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGAGATGAATCTTCCCG -3'
(R):5'- TCAGGTGTCAAAAGGTTGATTGC -3'

Sequencing Primer
(F):5'- GAGATGAATCTTCCCGATTGAAAATG -3'
(R):5'- GGTTTCTTAAGGAACCTCTCTGAAG -3'
Posted On 2016-07-22