Incidental Mutation 'R5402:Plat'
ID430045
Institutional Source Beutler Lab
Gene Symbol Plat
Ensembl Gene ENSMUSG00000031538
Gene Nameplasminogen activator, tissue
Synonymst-PA, D8Ertd2e, tPA
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22757727-22782844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 22772722 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 148 (W148G)
Ref Sequence ENSEMBL: ENSMUSP00000033941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033941]
Predicted Effect probably damaging
Transcript: ENSMUST00000033941
AA Change: W148G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033941
Gene: ENSMUSG00000031538
AA Change: W148G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FN1 38 80 5.69e-15 SMART
EGF 82 117 4.92e-5 SMART
KR 122 207 3.77e-33 SMART
KR 211 296 4.39e-34 SMART
Tryp_SPc 308 553 6.59e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210960
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a key enzyme of the fibrinolytic pathway. The encoded protein undergoes proteolytic processing by plasmin to generate a heterodimeric serine protease that cleaves the proenzyme plasminogen to produce plasmin, a protease that is required to break down fibrin clots. Additionally, the encoded protein is involved in other biological processes such as synaptic plasticity, cell migration and tissue remodeling. Mice lacking the encoded protein display a reduction in long-term potentiation in hippocampus and conversely, transgenic mice overexpressing the encoded protein have increased and prolonged long-term potentiation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal behavior, CNS synpatic transmission, and response to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Plat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Plat APN 8 22776828 missense probably benign 0.00
IGL01918:Plat APN 8 22780437 missense possibly damaging 0.82
IGL01998:Plat APN 8 22767147 missense probably benign 0.31
IGL02978:Plat APN 8 22776819 missense probably damaging 1.00
R0829:Plat UTSW 8 22772257 missense probably damaging 1.00
R1065:Plat UTSW 8 22776863 missense probably damaging 0.99
R2316:Plat UTSW 8 22776865 missense probably benign 0.04
R4485:Plat UTSW 8 22772212 missense probably benign 0.01
R4873:Plat UTSW 8 22768450 missense probably benign 0.03
R4875:Plat UTSW 8 22768450 missense probably benign 0.03
R4924:Plat UTSW 8 22778253 missense probably damaging 1.00
R5051:Plat UTSW 8 22773672 missense probably benign 0.01
R5062:Plat UTSW 8 22772311 missense probably benign 0.19
R5672:Plat UTSW 8 22773648 missense probably benign 0.40
R6306:Plat UTSW 8 22772266 missense possibly damaging 0.83
R7035:Plat UTSW 8 22772311 missense probably benign 0.32
R7154:Plat UTSW 8 22778505 missense possibly damaging 0.76
R7297:Plat UTSW 8 22775697 missense probably benign 0.12
R7432:Plat UTSW 8 22773651 missense probably damaging 0.99
R7514:Plat UTSW 8 22775642 missense probably damaging 1.00
R7679:Plat UTSW 8 22772232 missense probably damaging 1.00
R7680:Plat UTSW 8 22772232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGGCTGTAGCACTTCTAG -3'
(R):5'- TCTAGAATACGTGGCTGATTGGC -3'

Sequencing Primer
(F):5'- TCACTTTGAGCACCGGCAG -3'
(R):5'- CTCCTGTGGAAAGCACTT -3'
Posted On2016-09-06