Incidental Mutation 'R5526:Runx2'
ID431887
Institutional Source Beutler Lab
Gene Symbol Runx2
Ensembl Gene ENSMUSG00000039153
Gene Namerunt related transcription factor 2
Synonymspolyomavirus enhancer binding factor 2 (PEBP2), Pebpa2a, AML3, Osf2, PEBP2aA, PEBP2 alpha A, Cbfa1, SL3-3 enhancer factor 1
MMRRC Submission 043084-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5526 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location44495987-44814797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44724862 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 148 (T148P)
Ref Sequence ENSEMBL: ENSMUSP00000123707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113568] [ENSMUST00000113571] [ENSMUST00000113572] [ENSMUST00000159943] [ENSMUST00000160673] [ENSMUST00000162373] [ENSMUST00000162629] [ENSMUST00000162816] [ENSMUST00000162878]
Predicted Effect unknown
Transcript: ENSMUST00000113568
AA Change: Y101S
Predicted Effect probably damaging
Transcript: ENSMUST00000113571
AA Change: T162P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109201
Gene: ENSMUSG00000039153
AA Change: T162P

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113572
AA Change: T148P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109202
Gene: ENSMUSG00000039153
AA Change: T148P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 31 75 N/A INTRINSIC
Pfam:Runt 92 226 3.6e-83 PFAM
Pfam:RunxI 420 514 2.7e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159943
AA Change: T162P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124918
Gene: ENSMUSG00000039153
AA Change: T162P

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160199
AA Change: T24P
SMART Domains Protein: ENSMUSP00000125196
Gene: ENSMUSG00000039153
AA Change: T24P

DomainStartEndE-ValueType
Pfam:Runt 4 101 3.3e-56 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160672
AA Change: Y45S
Predicted Effect probably damaging
Transcript: ENSMUST00000160673
AA Change: T230P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123743
Gene: ENSMUSG00000039153
AA Change: T230P

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
coiled coil region 113 157 N/A INTRINSIC
Pfam:Runt 177 306 3.9e-75 PFAM
Pfam:RunxI 505 596 3.2e-41 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162130
AA Change: T58P
SMART Domains Protein: ENSMUSP00000124199
Gene: ENSMUSG00000039153
AA Change: T58P

DomainStartEndE-ValueType
Pfam:Runt 6 135 8e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162373
AA Change: T148P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124494
Gene: ENSMUSG00000039153
AA Change: T148P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 31 75 N/A INTRINSIC
Pfam:Runt 92 226 3.3e-83 PFAM
Pfam:RunxI 398 492 2.5e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162629
AA Change: T162P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124374
Gene: ENSMUSG00000039153
AA Change: T162P

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 3.5e-83 PFAM
Pfam:RunxI 412 506 2.7e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162816
AA Change: T148P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125498
Gene: ENSMUSG00000039153
AA Change: T148P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 31 75 N/A INTRINSIC
Pfam:Runt 92 226 8e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162878
AA Change: T148P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123707
Gene: ENSMUSG00000039153
AA Change: T148P

DomainStartEndE-ValueType
Pfam:Med15 6 224 1.4e-6 PFAM
Pfam:Runt 92 192 8.1e-54 PFAM
Pfam:RunxI 327 420 5.8e-41 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, decreased body weight, abnormal hematopoiesis, and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,125 V486A possibly damaging Het
Abca12 A T 1: 71,292,446 M1315K probably benign Het
Abcc4 C T 14: 118,631,037 V168I probably benign Het
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Angpt1 A G 15: 42,512,341 L173P probably damaging Het
BC067074 T C 13: 113,367,893 V1852A probably benign Het
Crls1 T A 2: 132,861,245 M205K possibly damaging Het
Dhtkd1 A T 2: 5,911,851 N671K probably damaging Het
Dmbt1 A T 7: 131,041,190 D246V probably damaging Het
Dolk G A 2: 30,285,808 A75V probably damaging Het
Dtna T A 18: 23,646,230 V623E probably damaging Het
Elavl3 T C 9: 22,036,326 T106A probably benign Het
Ergic1 T C 17: 26,624,678 C41R probably damaging Het
Fat2 T A 11: 55,269,361 I3309F possibly damaging Het
Fbn1 C A 2: 125,365,639 R978L possibly damaging Het
Fzd6 A T 15: 39,031,164 S242C possibly damaging Het
Galntl6 T A 8: 58,472,970 H87L probably benign Het
Gatad2a T C 8: 69,935,941 E32G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm11541 G T 11: 94,704,118 H41Q unknown Het
Has3 A G 8: 106,873,947 T14A probably damaging Het
Kmt2b A G 7: 30,580,444 L1377P probably damaging Het
Lcorl T C 5: 45,733,727 N428S probably benign Het
Lipo5 A T 19: 33,467,884 V95D unknown Het
Lrp1 A T 10: 127,555,724 V2942D probably benign Het
Map1a T C 2: 121,305,662 S2082P probably damaging Het
Mast4 T C 13: 102,754,215 S852G possibly damaging Het
Mlh3 A T 12: 85,269,373 L13* probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nlrp9c T A 7: 26,382,366 N645I possibly damaging Het
Olfr109 T A 17: 37,467,112 L302Q unknown Het
Olfr1126 T C 2: 87,457,765 I200T probably benign Het
Olfr128 T A 17: 37,924,492 *309K probably null Het
Olfr857 C A 9: 19,713,698 Y290* probably null Het
Olfr965 A T 9: 39,719,596 Y123F possibly damaging Het
Pex12 A G 11: 83,296,264 V286A possibly damaging Het
Phax C T 18: 56,584,310 T275I probably damaging Het
Phf21b A G 15: 84,791,805 V335A probably benign Het
Psg18 A T 7: 18,349,348 L173H probably damaging Het
Rab3ip T C 10: 116,918,929 T209A possibly damaging Het
Ralgapb T C 2: 158,432,785 V202A probably damaging Het
Rpn2 T C 2: 157,323,267 L611P probably damaging Het
Sbpl C A 17: 23,954,649 D50Y probably damaging Het
Scn5a G A 9: 119,521,171 P879L probably damaging Het
Sfn T C 4: 133,601,604 R56G probably damaging Het
Tas2r138 C T 6: 40,612,980 A111T probably benign Het
Tasp1 A T 2: 140,008,789 S105T probably damaging Het
Tmem225 T G 9: 40,150,706 H205Q possibly damaging Het
Tmprss7 A G 16: 45,660,904 S640P probably damaging Het
Utp4 G A 8: 106,917,633 A535T possibly damaging Het
Vmn1r203 A T 13: 22,524,103 D18V probably benign Het
Vmn2r58 A G 7: 41,872,645 L9P probably benign Het
Zcchc2 T A 1: 106,030,254 C420* probably null Het
Zfp804a A G 2: 82,258,590 D921G probably benign Het
Other mutations in Runx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Runx2 APN 17 44658599 missense probably damaging 1.00
IGL02029:Runx2 APN 17 44658687 nonsense probably null
IGL02084:Runx2 APN 17 44724829 missense probably damaging 1.00
R0040:Runx2 UTSW 17 44608254 missense possibly damaging 0.58
R0627:Runx2 UTSW 17 44658505 intron probably benign
R0944:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R1514:Runx2 UTSW 17 44735337 missense possibly damaging 0.54
R2069:Runx2 UTSW 17 44735342 missense probably benign 0.19
R3976:Runx2 UTSW 17 44610079 missense possibly damaging 0.91
R4686:Runx2 UTSW 17 44639685 missense probably damaging 1.00
R4911:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R5241:Runx2 UTSW 17 44639777 nonsense probably null
R6566:Runx2 UTSW 17 44814488 critical splice donor site probably null
R6874:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6875:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6980:Runx2 UTSW 17 44735316 missense possibly damaging 0.65
R7008:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7009:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7057:Runx2 UTSW 17 44814537 missense probably null
R7085:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7175:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7176:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7177:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7181:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7231:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7232:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7254:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7267:Runx2 UTSW 17 44814192 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGCTTGCACCAGAGAGC -3'
(R):5'- ATCGCCAGTGTATTTGAAGTGG -3'

Sequencing Primer
(F):5'- GAGCCTAACGCGCTTATCC -3'
(R):5'- GTGTATTTGAAGTGGTATCACAACCC -3'
Posted On2016-10-05