Incidental Mutation 'R8806:Runx2'
ID672101
Institutional Source Beutler Lab
Gene Symbol Runx2
Ensembl Gene ENSMUSG00000039153
Gene Namerunt related transcription factor 2
Synonymspolyomavirus enhancer binding factor 2 (PEBP2), Pebpa2a, AML3, Osf2, PEBP2aA, PEBP2 alpha A, Cbfa1, SL3-3 enhancer factor 1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8806 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location44495987-44814797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44639683 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 410 (V410L)
Ref Sequence ENSEMBL: ENSMUSP00000123743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113568] [ENSMUST00000113571] [ENSMUST00000113572] [ENSMUST00000159943] [ENSMUST00000160673] [ENSMUST00000162373] [ENSMUST00000162629] [ENSMUST00000162816] [ENSMUST00000162878]
Predicted Effect probably benign
Transcript: ENSMUST00000113568
Predicted Effect probably benign
Transcript: ENSMUST00000113571
AA Change: V342L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109201
Gene: ENSMUSG00000039153
AA Change: V342L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113572
AA Change: V328L

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109202
Gene: ENSMUSG00000039153
AA Change: V328L

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 31 75 N/A INTRINSIC
Pfam:Runt 92 226 3.6e-83 PFAM
Pfam:RunxI 420 514 2.7e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159943
AA Change: V342L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124918
Gene: ENSMUSG00000039153
AA Change: V342L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125196
Gene: ENSMUSG00000039153
AA Change: V146L

DomainStartEndE-ValueType
Pfam:Runt 4 101 3.3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160672
Predicted Effect probably benign
Transcript: ENSMUST00000160673
AA Change: V410L

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123743
Gene: ENSMUSG00000039153
AA Change: V410L

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
coiled coil region 113 157 N/A INTRINSIC
Pfam:Runt 177 306 3.9e-75 PFAM
Pfam:RunxI 505 596 3.2e-41 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124199
Gene: ENSMUSG00000039153
AA Change: V180L

DomainStartEndE-ValueType
Pfam:Runt 6 135 8e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162373
AA Change: V328L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000124494
Gene: ENSMUSG00000039153
AA Change: V328L

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 31 75 N/A INTRINSIC
Pfam:Runt 92 226 3.3e-83 PFAM
Pfam:RunxI 398 492 2.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162629
AA Change: V342L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124374
Gene: ENSMUSG00000039153
AA Change: V342L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 3.5e-83 PFAM
Pfam:RunxI 412 506 2.7e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162816
AA Change: V270L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125498
Gene: ENSMUSG00000039153
AA Change: V270L

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 31 75 N/A INTRINSIC
Pfam:Runt 92 226 8e-83 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162878
AA Change: V235L

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123707
Gene: ENSMUSG00000039153
AA Change: V235L

DomainStartEndE-ValueType
Pfam:Med15 6 224 1.4e-6 PFAM
Pfam:Runt 92 192 8.1e-54 PFAM
Pfam:RunxI 327 420 5.8e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, decreased body weight, abnormal hematopoiesis, and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,261 D198G probably benign Het
Abca1 T C 4: 53,084,520 M586V probably benign Het
Adam6b G A 12: 113,491,798 R745H possibly damaging Het
Afg3l1 A G 8: 123,493,918 D462G probably damaging Het
Anapc1 T A 2: 128,622,413 Q1721L possibly damaging Het
Arhgap11a T C 2: 113,834,762 Y497C possibly damaging Het
Bcl7b T G 5: 135,179,970 S96A possibly damaging Het
Birc6 T C 17: 74,642,316 V3111A probably damaging Het
Cbx1 A G 11: 96,801,557 D90G possibly damaging Het
Ccdc105 A G 10: 78,752,472 V168A probably damaging Het
Cdkl3 T C 11: 52,032,468 F524S possibly damaging Het
Cops7b G A 1: 86,589,309 G44R probably damaging Het
D130043K22Rik A G 13: 24,899,635 S1028G probably benign Het
Decr1 T A 4: 15,945,351 M1L probably benign Het
Dmtn T C 14: 70,614,948 I167V probably benign Het
Dnah9 A G 11: 65,859,483 L3932P probably damaging Het
Ece1 T A 4: 137,945,141 I365N probably damaging Het
Exo5 T C 4: 120,922,405 T88A probably benign Het
Frem3 T C 8: 80,663,435 Y1772H probably benign Het
Gm11639 T A 11: 105,037,869 M4815K probably benign Het
Gm5160 A G 18: 14,424,874 N3D possibly damaging Het
Gm7138 T A 10: 77,776,883 D21V unknown Het
Gucy2e A G 11: 69,236,116 V177A probably benign Het
Islr C A 9: 58,156,973 G417V unknown Het
Kif13a A T 13: 46,761,337 M1458K possibly damaging Het
Mcm7 T C 5: 138,165,085 D642G possibly damaging Het
Med24 A T 11: 98,705,144 I941N probably damaging Het
Mrgprb8 C T 7: 48,389,228 P216S possibly damaging Het
Myo5c T A 9: 75,242,772 V13D probably damaging Het
N4bp2 T A 5: 65,808,208 I1200K possibly damaging Het
Naip6 G A 13: 100,300,653 T454M possibly damaging Het
Nfkb1 T C 3: 135,589,452 Y877C probably damaging Het
Nolc1 C A 19: 46,083,032 S473R unknown Het
Nop16 A C 13: 54,589,859 probably benign Het
Nr3c2 T C 8: 77,242,463 I959T probably damaging Het
Nup88 T G 11: 70,944,115 K692N probably benign Het
Nvl C A 1: 181,095,054 G818V probably benign Het
Olfr1046 T C 2: 86,216,856 I285V probably damaging Het
Olfr1193 T C 2: 88,678,611 V245A probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr731 T A 14: 50,237,919 E322V probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr913 A T 9: 38,595,109 D296V probably damaging Het
Plxnc1 G A 10: 94,799,278 S1362L probably damaging Het
Ppfia2 C T 10: 106,858,253 A696V probably damaging Het
Prl A G 13: 27,059,532 Y62C probably damaging Het
Rnf135 A G 11: 80,198,936 D366G probably damaging Het
Rrp8 A G 7: 105,735,037 L86P probably damaging Het
Rsph4a T C 10: 33,909,449 V452A probably damaging Het
Samd9l T C 6: 3,376,665 T199A probably damaging Het
Sik3 T C 9: 46,209,067 S745P probably damaging Het
Slc35e1 T A 8: 72,488,129 S250C probably damaging Het
Snx31 A G 15: 36,537,552 F160S probably damaging Het
Stim2 T A 5: 53,998,915 V11E probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tox4 T C 14: 52,286,861 S151P probably damaging Het
Trim34b A T 7: 104,336,112 D318V probably damaging Het
Ubtd1 T C 19: 42,033,756 S156P probably damaging Het
Usp34 C A 11: 23,484,143 L3240M Het
Vmn1r56 T C 7: 5,195,806 S271G probably damaging Het
Vps13b T C 15: 35,472,066 probably benign Het
Vps13c T C 9: 67,945,828 F2401S probably damaging Het
Zbtb11 G A 16: 55,982,274 V216I probably damaging Het
Zfp931 T C 2: 178,067,796 T266A possibly damaging Het
Zfp956 A G 6: 47,956,108 M106V probably benign Het
Other mutations in Runx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Runx2 APN 17 44658599 missense probably damaging 1.00
IGL02029:Runx2 APN 17 44658687 nonsense probably null
IGL02084:Runx2 APN 17 44724829 missense probably damaging 1.00
R0040:Runx2 UTSW 17 44608254 missense possibly damaging 0.58
R0627:Runx2 UTSW 17 44658505 intron probably benign
R0944:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R1514:Runx2 UTSW 17 44735337 missense possibly damaging 0.54
R2069:Runx2 UTSW 17 44735342 missense probably benign 0.19
R3976:Runx2 UTSW 17 44610079 missense possibly damaging 0.91
R4686:Runx2 UTSW 17 44639685 missense probably damaging 1.00
R4911:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R5241:Runx2 UTSW 17 44639777 nonsense probably null
R5526:Runx2 UTSW 17 44724862 missense probably damaging 1.00
R6566:Runx2 UTSW 17 44814488 critical splice donor site probably null
R6874:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6875:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6980:Runx2 UTSW 17 44735316 missense possibly damaging 0.65
R7008:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7009:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7057:Runx2 UTSW 17 44814537 missense probably null
R7085:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7175:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7176:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7177:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7181:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7231:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7232:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7254:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7267:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7835:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R7949:Runx2 UTSW 17 44735555 missense possibly damaging 0.45
R8474:Runx2 UTSW 17 44608260 missense probably damaging 1.00
R8913:Runx2 UTSW 17 44608282 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CGGGCAGATTTTCATCTCTTGAG -3'
(R):5'- GGACTACTGAAAGGGTTTTGCG -3'

Sequencing Primer
(F):5'- CAAGCGTTTGATAGCCCCGTAAATG -3'
(R):5'- CTACTGAAAGGGTTTTGCGTTTCATC -3'
Posted On2021-04-30