Mutagenetix > Incidental Mutation

Incidental Mutation 'R5462:Vmn2r111'

433086

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

043024-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R5462 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22766922-22792254 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22767238 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 753 (Y753C)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably damaging
Transcript: ENSMUST00000092491
AA Change: Y753C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: Y753C

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	A	16: 4,682,227 (GRCm39)	G180E	probably damaging	Het
4933412E24Rik	A	G	15: 59,886,917 (GRCm39)	F508L	probably benign	Het
Acyp2	C	T	11: 30,456,354 (GRCm39)	E98K	possibly damaging	Het
Amz1	A	G	5: 140,733,976 (GRCm39)	Y184C	probably damaging	Het
Calm3	A	T	7: 16,651,619 (GRCm39)	D23E	possibly damaging	Het
Cep112	T	A	11: 108,409,570 (GRCm39)	N479K	probably damaging	Het
Cfap251	T	C	5: 123,436,695 (GRCm39)		probably null	Het
Csmd1	A	C	8: 16,011,486 (GRCm39)	N2522K	probably benign	Het
Dhx30	A	G	9: 109,930,042 (GRCm39)	L18P	probably damaging	Het
E2f2	A	T	4: 135,900,224 (GRCm39)	T45S	probably benign	Het
Grk3	T	C	5: 113,117,074 (GRCm39)	Y67C	probably damaging	Het
Htt	T	A	5: 35,042,851 (GRCm39)	C2290*	probably null	Het
Igsf10	T	C	3: 59,233,175 (GRCm39)	T1853A	probably damaging	Het
Kmt2d	G	A	15: 98,749,990 (GRCm39)		probably benign	Het
Mast2	A	G	4: 116,164,655 (GRCm39)	L1587P	probably damaging	Het
Mdn1	A	G	4: 32,720,897 (GRCm39)	N2337D	probably benign	Het
Mettl3	T	C	14: 52,537,336 (GRCm39)	Q182R	probably damaging	Het
Mterf1b	A	G	5: 4,246,541 (GRCm39)	S61G	probably benign	Het
Mycbp2	T	C	14: 103,437,562 (GRCm39)	Y2100C	probably damaging	Het
Nt5m	T	A	11: 59,765,385 (GRCm39)	W138R	probably damaging	Het
Or5g29	A	G	2: 85,421,640 (GRCm39)	Y252C	probably damaging	Het
Prex1	A	G	2: 166,486,728 (GRCm39)	Y114H	probably benign	Het
Rasa2	A	T	9: 96,453,971 (GRCm39)	S322T	probably damaging	Het
Sis	A	T	3: 72,857,171 (GRCm39)	D373E	probably damaging	Het
Snx29	A	T	16: 11,328,876 (GRCm39)	M552L	possibly damaging	Het
Sptbn1	G	T	11: 30,050,520 (GRCm39)	F2356L	possibly damaging	Het
Tbc1d10c	G	T	19: 4,238,052 (GRCm39)	Q241K	probably benign	Het
Vmn1r222	A	G	13: 23,417,045 (GRCm39)	I56T	probably benign	Het
Vmn2r37	A	G	7: 9,220,973 (GRCm39)	W297R	probably damaging	Het
Zbtb47	G	T	9: 121,596,729 (GRCm39)	R695L	probably damaging	Het
Zfp267	C	T	3: 36,219,969 (GRCm39)	T664I	possibly damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22,767,734 (GRCm39)	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22,787,965 (GRCm39)	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22,787,997 (GRCm39)	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22,790,966 (GRCm39)	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22,767,718 (GRCm39)	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22,767,553 (GRCm39)	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22,790,373 (GRCm39)	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22,788,054 (GRCm39)	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22,767,265 (GRCm39)	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22,789,754 (GRCm39)	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22,787,837 (GRCm39)	missense	probably benign
IGL02519:Vmn2r111	APN	17	22,767,320 (GRCm39)	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22,790,031 (GRCm39)	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22,792,205 (GRCm39)	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22,778,023 (GRCm39)	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22,790,226 (GRCm39)	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22,789,839 (GRCm39)	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22,766,990 (GRCm39)	missense	probably benign
R0064:Vmn2r111	UTSW	17	22,791,053 (GRCm39)	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22,792,102 (GRCm39)	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22,790,097 (GRCm39)	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22,790,028 (GRCm39)	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22,790,028 (GRCm39)	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22,790,380 (GRCm39)	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22,788,042 (GRCm39)	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22,788,042 (GRCm39)	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22,767,041 (GRCm39)	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22,767,062 (GRCm39)	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22,767,395 (GRCm39)	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22,778,043 (GRCm39)	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22,792,085 (GRCm39)	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22,778,151 (GRCm39)	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22,790,142 (GRCm39)	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22,790,301 (GRCm39)	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22,778,096 (GRCm39)	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22,792,159 (GRCm39)	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22,767,637 (GRCm39)	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22,767,022 (GRCm39)	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22,790,124 (GRCm39)	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22,790,001 (GRCm39)	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22,767,083 (GRCm39)	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22,792,252 (GRCm39)	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22,767,470 (GRCm39)	missense	probably damaging	0.99
R6149:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6149:Vmn2r111	UTSW	17	22,767,796 (GRCm39)	missense	probably benign	0.00
R6207:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22,792,070 (GRCm39)	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22,790,889 (GRCm39)	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22,767,583 (GRCm39)	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22,790,226 (GRCm39)	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22,767,165 (GRCm39)	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22,767,695 (GRCm39)	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22,790,067 (GRCm39)	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22,767,380 (GRCm39)	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22,789,714 (GRCm39)	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22,792,083 (GRCm39)	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22,790,469 (GRCm39)	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22,792,073 (GRCm39)	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22,767,562 (GRCm39)	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22,790,274 (GRCm39)	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22,778,024 (GRCm39)	missense	probably damaging	1.00
R8540:Vmn2r111	UTSW	17	22,778,023 (GRCm39)	critical splice donor site	probably null
R8557:Vmn2r111	UTSW	17	22,790,910 (GRCm39)	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22,792,194 (GRCm39)	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22,767,239 (GRCm39)	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22,767,011 (GRCm39)	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22,790,822 (GRCm39)	missense	probably benign
R9374:Vmn2r111	UTSW	17	22,787,859 (GRCm39)	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22,778,132 (GRCm39)	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22,767,676 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTGCACTGGAAGCCAAAGTG -3'
(R):5'- AGCCTCTCAAAGAATGATGAAGTAC -3'

Sequencing Primer
(F):5'- AGCCAAAGTGGAGAAGATCTC -3'
(R):5'- CTAGTTTCAGGGGCATCTAACTAC -3'

Posted On

2016-10-06