Incidental Mutation 'R5469:Ryk'
ID433413
Institutional Source Beutler Lab
Gene Symbol Ryk
Ensembl Gene ENSMUSG00000032547
Gene Namereceptor-like tyrosine kinase
SynonymsVik, ERK-3
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5469 (G1)
Quality Score204
Status Not validated
Chromosome9
Chromosomal Location102834917-102908305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102906954 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 593 (Y593C)
Ref Sequence ENSEMBL: ENSMUSP00000135858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035142] [ENSMUST00000175883] [ENSMUST00000176198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035142
AA Change: Y590C

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035142
Gene: ENSMUSG00000032547
AA Change: Y590C

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
WIF 47 180 9.24e-82 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 247 266 N/A INTRINSIC
TyrKc 314 580 1.76e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175883
AA Change: Y593C

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135858
Gene: ENSMUSG00000032547
AA Change: Y593C

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
WIF 47 180 9.24e-82 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 247 266 N/A INTRINSIC
TyrKc 317 583 1.76e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176198
SMART Domains Protein: ENSMUSP00000135396
Gene: ENSMUSG00000032547

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an atypical member of the family of growth factor receptor protein tyrosine kinases, differing from other members at a number of conserved residues in the activation and nucleotide binding domains. This gene product belongs to a subfamily whose members do not appear to be regulated by phosphorylation in the activation segment. It has been suggested that mediation of biological activity by recruitment of a signaling-competent auxiliary protein may occur through an as yet uncharacterized mechanism. The encoded protein has a leucine-rich extracellular domain with a WIF-type Wnt binding region, a single transmembrane domain, and an intracellular tyrosine kinase domain. This protein is involved in stimulating Wnt signaling pathways such as the regulation of axon pathfinding. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice have a distinctive craniofacial appearance, shortened limbs and postnatal mortality due to feeding and respiratory complications associated with a complete cleft of the secondary palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Ryk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Ryk APN 9 102897266 missense probably benign 0.38
R1168:Ryk UTSW 9 102898475 missense probably damaging 1.00
R1827:Ryk UTSW 9 102888507 missense probably benign 0.03
R2030:Ryk UTSW 9 102881656 missense possibly damaging 0.90
R2084:Ryk UTSW 9 102875772 missense probably damaging 1.00
R3870:Ryk UTSW 9 102891228 missense probably damaging 0.96
R4675:Ryk UTSW 9 102891216 missense possibly damaging 0.94
R5195:Ryk UTSW 9 102867613 missense probably benign 0.00
R5338:Ryk UTSW 9 102897317 nonsense probably null
R6668:Ryk UTSW 9 102869276 missense possibly damaging 0.75
R7340:Ryk UTSW 9 102898538 missense probably damaging 0.99
R7545:Ryk UTSW 9 102888473 missense probably damaging 1.00
R7602:Ryk UTSW 9 102898516 missense probably damaging 1.00
R7694:Ryk UTSW 9 102898780 missense probably damaging 1.00
R7817:Ryk UTSW 9 102891233 nonsense probably null
X0020:Ryk UTSW 9 102881743 missense probably damaging 0.96
X0066:Ryk UTSW 9 102869410 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTAACAGTACAGCTAAGCG -3'
(R):5'- GTGGTATCTAGAAAACACTCTGCG -3'

Sequencing Primer
(F):5'- GCTAACAGTACAGCTAAGCGATTGC -3'
(R):5'- TCTAGAAAACACTCTGCGTTATTAC -3'
Posted On2016-10-06