Incidental Mutation 'R5469:Rad51ap1'
ID457921
Institutional Source Beutler Lab
Gene Symbol Rad51ap1
Ensembl Gene ENSMUSG00000030346
Gene NameRAD51 associated protein 1
SynonymsRAB22, 2510006L10Rik
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location126923050-126939587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126928227 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 107 (S107N)
Ref Sequence ENSEMBL: ENSMUSP00000107839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112220] [ENSMUST00000112221] [ENSMUST00000144954] [ENSMUST00000202897]
Predicted Effect probably damaging
Transcript: ENSMUST00000112220
AA Change: S107N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107839
Gene: ENSMUSG00000030346
AA Change: S107N

DomainStartEndE-ValueType
low complexity region 179 204 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112221
AA Change: S107N

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107841
Gene: ENSMUSG00000030346
AA Change: S107N

DomainStartEndE-ValueType
low complexity region 180 205 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
Pfam:RAD51_interact 293 331 1.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141212
Predicted Effect probably benign
Transcript: ENSMUST00000144954
SMART Domains Protein: ENSMUSP00000122978
Gene: ENSMUSG00000030346

DomainStartEndE-ValueType
low complexity region 121 146 N/A INTRINSIC
low complexity region 153 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202835
Predicted Effect probably benign
Transcript: ENSMUST00000202897
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Rad51ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Rad51ap1 APN 6 126928160 missense probably damaging 1.00
IGL02371:Rad51ap1 APN 6 126927564 missense probably benign 0.14
IGL02398:Rad51ap1 APN 6 126928151 missense probably damaging 1.00
R0265:Rad51ap1 UTSW 6 126924197 makesense probably null
R0359:Rad51ap1 UTSW 6 126934741 missense probably damaging 1.00
R0488:Rad51ap1 UTSW 6 126934760 missense possibly damaging 0.94
R1527:Rad51ap1 UTSW 6 126928167 splice site probably null
R3018:Rad51ap1 UTSW 6 126939522 start gained probably null
R4464:Rad51ap1 UTSW 6 126934768 missense possibly damaging 0.94
R4691:Rad51ap1 UTSW 6 126927553 missense probably benign
R5314:Rad51ap1 UTSW 6 126928158 missense probably damaging 1.00
R7177:Rad51ap1 UTSW 6 126925020 missense probably benign 0.08
R8026:Rad51ap1 UTSW 6 126934712 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTTAACAAGGAAGGCTGTTC -3'
(R):5'- AGTGTACGTCTGGAGTCTGAC -3'

Sequencing Primer
(F):5'- ATCACTGGCTACACTGCA -3'
(R):5'- AGTCTGACTGTGAACCTGAGTC -3'
Posted On2017-02-16