Incidental Mutation 'R5469:Ccne2'
ID433395
Institutional Source Beutler Lab
Gene Symbol Ccne2
Ensembl Gene ENSMUSG00000028212
Gene Namecyclin E2
Synonyms
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11191351-11204779 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 11201353 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 294 (R294*)
Ref Sequence ENSEMBL: ENSMUSP00000130693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029866] [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319] [ENSMUST00000108324] [ENSMUST00000170901]
Predicted Effect probably null
Transcript: ENSMUST00000029866
AA Change: R293*
SMART Domains Protein: ENSMUSP00000029866
Gene: ENSMUSG00000028212
AA Change: R293*

DomainStartEndE-ValueType
CYCLIN 146 231 2.16e-24 SMART
Cyclin_C 240 362 5.49e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044616
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108318
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108319
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108324
AA Change: R294*
SMART Domains Protein: ENSMUSP00000103960
Gene: ENSMUSG00000028212
AA Change: R294*

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145252
Predicted Effect probably null
Transcript: ENSMUST00000170901
AA Change: R294*
SMART Domains Protein: ENSMUSP00000130693
Gene: ENSMUSG00000028212
AA Change: R294*

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for disruptions in this gene are phenotypically normal. Male mice show reduced fertility but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Ccne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Ccne2 APN 4 11199322 missense probably benign 0.01
IGL02207:Ccne2 APN 4 11202261 missense probably benign 0.00
IGL02885:Ccne2 APN 4 11198723 splice site probably benign
R0367:Ccne2 UTSW 4 11201426 splice site probably benign
R0686:Ccne2 UTSW 4 11197220 missense possibly damaging 0.93
R1056:Ccne2 UTSW 4 11192707 missense probably damaging 0.99
R1068:Ccne2 UTSW 4 11192850 missense probably benign
R2076:Ccne2 UTSW 4 11197177 missense probably damaging 1.00
R2167:Ccne2 UTSW 4 11197249 missense probably benign 0.00
R2190:Ccne2 UTSW 4 11197241 missense probably benign 0.02
R3724:Ccne2 UTSW 4 11203039 missense probably benign 0.09
R3766:Ccne2 UTSW 4 11199293 splice site probably benign
R4595:Ccne2 UTSW 4 11202986 missense probably benign
R5543:Ccne2 UTSW 4 11194026 missense probably benign 0.04
R5884:Ccne2 UTSW 4 11199411 missense probably benign 0.00
R6298:Ccne2 UTSW 4 11199306 missense probably damaging 1.00
R7493:Ccne2 UTSW 4 11198772 missense probably damaging 1.00
R7553:Ccne2 UTSW 4 11201348 missense probably benign 0.02
R7591:Ccne2 UTSW 4 11201393 missense probably benign
R7801:Ccne2 UTSW 4 11194079 critical splice donor site probably null
R7996:Ccne2 UTSW 4 11201347 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATGAAGTGCTCACCCTTC -3'
(R):5'- CCACTTGGCTGGGAATTTATTTTC -3'

Sequencing Primer
(F):5'- ACATTATCACTGTGCTCCTAGAAC -3'
(R):5'- GTGAACAGGTACAAAGTCAAC -3'
Posted On2016-10-06