Incidental Mutation 'R5481:Chpf2'
ID434314
Institutional Source Beutler Lab
Gene Symbol Chpf2
Ensembl Gene ENSMUSG00000038181
Gene Namechondroitin polymerizing factor 2
Synonyms2010209O12Rik
MMRRC Submission 043042-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5481 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24586741-24594556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24589342 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 170 (H170L)
Ref Sequence ENSEMBL: ENSMUSP00000112804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect probably benign
Transcript: ENSMUST00000030791
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000088295
AA Change: H170L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181
AA Change: H170L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102432
Predicted Effect probably damaging
Transcript: ENSMUST00000121863
AA Change: H170L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181
AA Change: H170L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144995
Predicted Effect probably benign
Transcript: ENSMUST00000195943
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198521
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 95.1%
  • 20x: 90.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,562 S187P probably damaging Het
Aass C A 6: 23,113,476 V282L probably benign Het
Adh6a G T 3: 138,325,958 V204F probably damaging Het
Aspm A G 1: 139,457,061 K148E possibly damaging Het
Atp12a A T 14: 56,373,389 D330V possibly damaging Het
Barhl1 A G 2: 28,915,340 Y114H probably damaging Het
BC106179 T A 16: 23,224,168 probably benign Het
Cabin1 A G 10: 75,735,066 L792P probably benign Het
Calcoco2 A G 11: 96,107,543 V18A probably damaging Het
Chrna1 T A 2: 73,566,926 I340F possibly damaging Het
Ckap5 A T 2: 91,572,447 I690F possibly damaging Het
Col10a1 A G 10: 34,395,664 H544R probably benign Het
Cyp2b19 A C 7: 26,766,821 T350P probably damaging Het
Dgkq A G 5: 108,648,810 probably null Het
Dnah1 A G 14: 31,308,871 V443A possibly damaging Het
Erbb3 T C 10: 128,572,480 D855G probably damaging Het
Fam3c T C 6: 22,321,358 D138G probably benign Het
Fen1 A G 19: 10,200,658 C141R probably damaging Het
Flnc G A 6: 29,441,217 G390D probably damaging Het
Fnip1 C A 11: 54,502,644 D635E probably benign Het
Fry A T 5: 150,260,319 L17F probably benign Het
Fsip2 T C 2: 82,979,886 I2183T probably benign Het
Gfpt1 T A 6: 87,050,969 I19N probably damaging Het
Gm9774 A G 3: 92,429,351 S15P possibly damaging Het
Hus1b T C 13: 30,946,959 D239G probably benign Het
Kif1a T C 1: 93,060,244 K546R probably benign Het
Kmt2d A G 15: 98,862,005 V1124A unknown Het
Krtap16-1 A G 11: 99,985,327 I417T probably damaging Het
Manba A T 3: 135,524,556 N297Y possibly damaging Het
Mblac1 A G 5: 138,194,816 D140G probably damaging Het
Mlh1 T C 9: 111,229,837 probably null Het
Morc1 T A 16: 48,561,485 probably null Het
Morc3 C A 16: 93,862,655 P449Q probably damaging Het
Mtr T C 13: 12,188,155 probably null Het
Mylk T A 16: 34,921,604 C829S probably benign Het
Myo1d A G 11: 80,663,095 I520T possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nos1 A T 5: 117,867,754 I180F probably benign Het
Ntsr1 C T 2: 180,541,520 T341M possibly damaging Het
Olfr916 A T 9: 38,657,620 F257L probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Peli2 C A 14: 48,252,633 N136K probably damaging Het
Pigt C A 2: 164,506,422 P429H probably damaging Het
Pik3r2 T C 8: 70,769,764 I515V probably benign Het
Pkhd1l1 A G 15: 44,558,646 Y3104C probably damaging Het
Ppp1r16a A C 15: 76,691,021 E43A probably damaging Het
Ptpn18 T C 1: 34,471,663 L260P possibly damaging Het
Scaf11 A T 15: 96,420,617 S355R probably damaging Het
Sema4a A T 3: 88,453,040 Y77* probably null Het
Serpinb9b T C 13: 33,038,093 V230A possibly damaging Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc22a30 T C 19: 8,336,837 N495S probably benign Het
Srcap G A 7: 127,532,197 G836D probably damaging Het
Stard4 A C 18: 33,205,245 C137W probably benign Het
Stat6 A G 10: 127,647,826 probably null Het
Steap3 T C 1: 120,241,724 D243G probably benign Het
Taf1c A G 8: 119,599,240 S628P probably damaging Het
Unkl C T 17: 25,201,172 Q13* probably null Het
Usp38 A G 8: 80,993,323 S426P possibly damaging Het
Vmn2r8 T C 5: 108,801,770 T404A probably benign Het
Washc1 T C 17: 66,118,865 V425A probably benign Het
Zfyve9 A G 4: 108,644,349 I590T probably damaging Het
Other mutations in Chpf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chpf2 APN 5 24592261 missense probably damaging 1.00
IGL02110:Chpf2 APN 5 24591712 missense probably damaging 1.00
IGL02625:Chpf2 APN 5 24591711 nonsense probably null
IGL02673:Chpf2 APN 5 24591304 missense probably benign 0.21
R0545:Chpf2 UTSW 5 24590324 missense possibly damaging 0.89
R0571:Chpf2 UTSW 5 24590427 missense probably damaging 1.00
R0732:Chpf2 UTSW 5 24590421 start codon destroyed probably null 0.94
R1196:Chpf2 UTSW 5 24589648 missense possibly damaging 0.61
R2051:Chpf2 UTSW 5 24591276 missense probably benign 0.00
R2057:Chpf2 UTSW 5 24591222 missense probably damaging 1.00
R2147:Chpf2 UTSW 5 24592035 missense probably damaging 1.00
R3719:Chpf2 UTSW 5 24590312 nonsense probably null
R4168:Chpf2 UTSW 5 24591790 missense possibly damaging 0.86
R4632:Chpf2 UTSW 5 24591831 missense probably benign
R5278:Chpf2 UTSW 5 24588090 intron probably benign
R5853:Chpf2 UTSW 5 24592192 missense probably damaging 1.00
R5914:Chpf2 UTSW 5 24592423 unclassified probably benign
R6010:Chpf2 UTSW 5 24591919 missense probably damaging 1.00
R6340:Chpf2 UTSW 5 24591775 missense probably damaging 0.98
R6463:Chpf2 UTSW 5 24589526 missense probably damaging 1.00
R8012:Chpf2 UTSW 5 24590345 missense probably damaging 0.98
R8506:Chpf2 UTSW 5 24588297 missense probably damaging 1.00
Z1177:Chpf2 UTSW 5 24591519 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGGTATATACAGACAGAGCTGG -3'
(R):5'- AGACTCCGTGACAACAGGTAG -3'

Sequencing Primer
(F):5'- GACTTCTCGAGCCACACTG -3'
(R):5'- TCCGTGACAACAGGTAGCCAAAG -3'
Posted On2016-10-06