Mutagenetix > Incidental Mutation

Incidental Mutation 'R5481:Ptpn18'

434294

Institutional Source

Beutler Lab

Gene Symbol

Ptpn18

Ensembl Gene

ENSMUSG00000026126

Gene Name

protein tyrosine phosphatase, non-receptor type 18

Synonyms

PTP-K1, FLP1, PTP-HSCF, HSCF, Ptpk1

MMRRC Submission

043042-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R5481 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34459762-34475733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34471663 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 260 (L260P)

Ref Sequence

ENSEMBL: ENSMUSP00000027302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000188972] [ENSMUST00000190122]

AlphaFold

Q61152

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027302
AA Change: L260P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: L260P

Domain	Start	End	E-Value	Type
PTPc	25	293	7.77e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185218

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185881

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186252

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188019

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188884

Predicted Effect

probably benign
Transcript: ENSMUST00000188972

Predicted Effect

probably benign
Transcript: ENSMUST00000190122
AA Change: L236P

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126
AA Change: L236P

Domain	Start	End	E-Value	Type
PTPc	2	269	9.1e-113	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191357

Coding Region Coverage

1x: 99.1%
3x: 97.6%
10x: 95.1%
20x: 90.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	G	4: 109,505,562	S187P	probably damaging	Het
Aass	C	A	6: 23,113,476	V282L	probably benign	Het
Adh6a	G	T	3: 138,325,958	V204F	probably damaging	Het
Aspm	A	G	1: 139,457,061	K148E	possibly damaging	Het
Atp12a	A	T	14: 56,373,389	D330V	possibly damaging	Het
Barhl1	A	G	2: 28,915,340	Y114H	probably damaging	Het
BC106179	T	A	16: 23,224,168		probably benign	Het
Cabin1	A	G	10: 75,735,066	L792P	probably benign	Het
Calcoco2	A	G	11: 96,107,543	V18A	probably damaging	Het
Chpf2	A	T	5: 24,589,342	H170L	probably damaging	Het
Chrna1	T	A	2: 73,566,926	I340F	possibly damaging	Het
Ckap5	A	T	2: 91,572,447	I690F	possibly damaging	Het
Col10a1	A	G	10: 34,395,664	H544R	probably benign	Het
Cyp2b19	A	C	7: 26,766,821	T350P	probably damaging	Het
Dgkq	A	G	5: 108,648,810		probably null	Het
Dnah1	A	G	14: 31,308,871	V443A	possibly damaging	Het
Erbb3	T	C	10: 128,572,480	D855G	probably damaging	Het
Fam3c	T	C	6: 22,321,358	D138G	probably benign	Het
Fen1	A	G	19: 10,200,658	C141R	probably damaging	Het
Flnc	G	A	6: 29,441,217	G390D	probably damaging	Het
Fnip1	C	A	11: 54,502,644	D635E	probably benign	Het
Fry	A	T	5: 150,260,319	L17F	probably benign	Het
Fsip2	T	C	2: 82,979,886	I2183T	probably benign	Het
Gfpt1	T	A	6: 87,050,969	I19N	probably damaging	Het
Gm9774	A	G	3: 92,429,351	S15P	possibly damaging	Het
Hus1b	T	C	13: 30,946,959	D239G	probably benign	Het
Kif1a	T	C	1: 93,060,244	K546R	probably benign	Het
Kmt2d	A	G	15: 98,862,005	V1124A	unknown	Het
Krtap16-1	A	G	11: 99,985,327	I417T	probably damaging	Het
Manba	A	T	3: 135,524,556	N297Y	possibly damaging	Het
Mblac1	A	G	5: 138,194,816	D140G	probably damaging	Het
Mlh1	T	C	9: 111,229,837		probably null	Het
Morc1	T	A	16: 48,561,485		probably null	Het
Morc3	C	A	16: 93,862,655	P449Q	probably damaging	Het
Mtr	T	C	13: 12,188,155		probably null	Het
Mylk	T	A	16: 34,921,604	C829S	probably benign	Het
Myo1d	A	G	11: 80,663,095	I520T	possibly damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Nos1	A	T	5: 117,867,754	I180F	probably benign	Het
Ntsr1	C	T	2: 180,541,520	T341M	possibly damaging	Het
Olfr916	A	T	9: 38,657,620	F257L	probably benign	Het
P2rx7	A	G	5: 122,680,820	D435G	possibly damaging	Het
Peli2	C	A	14: 48,252,633	N136K	probably damaging	Het
Pigt	C	A	2: 164,506,422	P429H	probably damaging	Het
Pik3r2	T	C	8: 70,769,764	I515V	probably benign	Het
Pkhd1l1	A	G	15: 44,558,646	Y3104C	probably damaging	Het
Ppp1r16a	A	C	15: 76,691,021	E43A	probably damaging	Het
Scaf11	A	T	15: 96,420,617	S355R	probably damaging	Het
Sema4a	A	T	3: 88,453,040	Y77*	probably null	Het
Serpinb9b	T	C	13: 33,038,093	V230A	possibly damaging	Het
Sfswap	T	A	5: 129,514,818	S300T	probably damaging	Het
Slc22a30	T	C	19: 8,336,837	N495S	probably benign	Het
Srcap	G	A	7: 127,532,197	G836D	probably damaging	Het
Stard4	A	C	18: 33,205,245	C137W	probably benign	Het
Stat6	A	G	10: 127,647,826		probably null	Het
Steap3	T	C	1: 120,241,724	D243G	probably benign	Het
Taf1c	A	G	8: 119,599,240	S628P	probably damaging	Het
Unkl	C	T	17: 25,201,172	Q13*	probably null	Het
Usp38	A	G	8: 80,993,323	S426P	possibly damaging	Het
Vmn2r8	T	C	5: 108,801,770	T404A	probably benign	Het
Washc1	T	C	17: 66,118,865	V425A	probably benign	Het
Zfyve9	A	G	4: 108,644,349	I590T	probably damaging	Het

Other mutations in Ptpn18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Ptpn18	APN	1	34463119	missense	probably damaging	0.98
IGL01611:Ptpn18	APN	1	34459817	utr 5 prime	probably benign
IGL01633:Ptpn18	APN	1	34471908	missense	probably benign	0.03
IGL03379:Ptpn18	APN	1	34470257	splice site	probably null
R0848:Ptpn18	UTSW	1	34462702	missense	probably damaging	1.00
R1400:Ptpn18	UTSW	1	34463506	critical splice donor site	probably null
R1973:Ptpn18	UTSW	1	34463109	missense	probably damaging	1.00
R2040:Ptpn18	UTSW	1	34470219	missense	probably damaging	0.99
R2113:Ptpn18	UTSW	1	34471661	missense	probably damaging	1.00
R2963:Ptpn18	UTSW	1	34471692	nonsense	probably null
R4061:Ptpn18	UTSW	1	34472930	missense	possibly damaging	0.66
R4062:Ptpn18	UTSW	1	34472930	missense	possibly damaging	0.66
R4509:Ptpn18	UTSW	1	34462742	missense	possibly damaging	0.49
R4522:Ptpn18	UTSW	1	34472960	missense	probably benign
R4626:Ptpn18	UTSW	1	34471792	splice site	probably null
R4978:Ptpn18	UTSW	1	34469813	intron	probably benign
R5260:Ptpn18	UTSW	1	34463510	splice site	probably benign
R5335:Ptpn18	UTSW	1	34463178	missense	probably damaging	1.00
R5865:Ptpn18	UTSW	1	34471563	splice site	probably benign
R7038:Ptpn18	UTSW	1	34459825	start codon destroyed	probably null	1.00
R7225:Ptpn18	UTSW	1	34472846	missense	possibly damaging	0.58
R7290:Ptpn18	UTSW	1	34462811	critical splice donor site	probably null
R7411:Ptpn18	UTSW	1	34472192	critical splice donor site	probably null
R7434:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7441:Ptpn18	UTSW	1	34473335	missense	probably benign	0.00
R7442:Ptpn18	UTSW	1	34462750	missense	probably benign	0.02
R7462:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7463:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7464:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7465:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7535:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7537:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7678:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7689:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7899:Ptpn18	UTSW	1	34469905	splice site	probably null
R8543:Ptpn18	UTSW	1	34472148	missense	probably benign	0.00
R8821:Ptpn18	UTSW	1	34472190	missense	probably null	1.00
R8831:Ptpn18	UTSW	1	34472190	missense	probably null	1.00
R8858:Ptpn18	UTSW	1	34463115	missense	possibly damaging	0.88
R8879:Ptpn18	UTSW	1	34463130	missense	probably benign	0.23
R8924:Ptpn18	UTSW	1	34459885	missense	probably benign	0.02
R9657:Ptpn18	UTSW	1	34473392	missense	possibly damaging	0.87
X0065:Ptpn18	UTSW	1	34469891	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGATTGTCAGTGCTGGCTG -3'
(R):5'- TGTTGATGGCTGGCAGAAAG -3'

Sequencing Primer
(F):5'- TGCGGACGAACAGGTGTC -3'
(R):5'- AAATTGGGGGCTCTGTACCTCC -3'

Posted On

2016-10-06